Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU072181

Sigma-Aldrich

MISSION® esiRNA

targeting human PITX2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCAAAGGGATGTCCTCAGTGTCTGACATCTTTCACTACAAGTATTTCTAACAGTTGCAAGGACACATACACAAACAAATGTTTGACTGGATATGACATTTTAACATTACTATAAGCTTGTTATTTTTTAAGTTTAGCATTGTTAACATTTAAATGACTGAAAGGATGTATATATATCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAGGTTAGGCTTTAAAATAAAGCATGTTATACAGAAGCGATTAGGATTTTTCGCTTGCGAGCAAGGGAGTGTATATACTAAATGCCACACTGTATGTTTCTAACATATTATTATTATTATAAAAAATGTGTGAATATCAGTTTTAGAATAGTTTCTCTGGTGGATGCAATGATG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Hsun Kao et al.
European journal of clinical investigation, 49(10), e13160-e13160 (2019-08-06)
A Pitx2c deficiency increases the risk of atrial fibrillation (AF). Atrial structural remodelling with fibrosis blocks electrical conduction and leads to arrhythmogenesis. A Pitx2c deficiency enhances profibrotic transforming growth factor (TGF)-β expression and calcium dysregulation, suggesting that Pitx2c may play
Estefanía Lozano-Velasco et al.
Cardiovascular research, 109(1), 55-66 (2015-08-06)
Atrial fibrillation (AF) is the most common type of arrhythmia in humans, yet the genetic cause of AF remains elusive. Genome-wide association studies (GWASs) have reported risk variants in four distinct genetic loci, and more recently, a meta-GWAS has further
Estefanía Lozano-Velasco et al.
Molecular and cellular biology, 35(17), 2892-2909 (2015-06-10)
The acquisition of a proliferating-cell status from a quiescent state as well as the shift between proliferation and differentiation are key developmental steps in skeletal-muscle stem cells (satellite cells) to provide proper muscle regeneration. However, how satellite cell proliferation is
Wing-Kee Lee et al.
Cancer letters, 449, 237-251 (2019-02-12)
Oncogenic pituitary homeobox 2 (PITX2), a de facto master regulator of developmental organ asymmetry, previously upregulated multidrug resistance (MDR) P-glycoprotein ABCB1 in A498 renal cell carcinoma (RCC) cells. The role of PITX2 isoforms in MDR cancers was investigated. Data mining
Ryuta Tanimoto et al.
Endocrinology, 156(1), 58-70 (2014-11-05)
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico