Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU071641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGA

Ensembl | human accession no.

ENSG00000165272

NCBI accession no.

NM_004925

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AQP3(360) , AQP3(360)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mariko Hara-Chikuma et al.
Biochemical and biophysical research communications, 471(4), 603-609 (2016-02-21)
Aquaporin 3 (AQP3), a water/glycerol channel protein, is capable of transporting hydrogen peroxide (H2O2). Here, we show that AQP3-mediated intracellular H2O2 is involved in epidermal growth factor (EGF)-induced cell signaling and its dependent cell function in the EGF receptor (EGFR)-positive
Ayah E Ahmad et al.
International journal of oncology, 56(4), 1014-1024 (2020-04-23)
Estrogen receptor (ER)‑silenced breast cancer cell lines exhibit endocrine resistance and morphological changes from an epithelial to a mesenchymal phenotype. These cells also display increased motility and invasive properties that are further accentuated by exposure to an alkaline pH, exhibiting
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
Hiroki Satooka et al.
Molecular and cellular biology, 36(7), 1206-1218 (2016-02-03)
Most breast cancer mortality is due to clinical relapse associated with metastasis. CXCL12/CXCR4-dependent cell migration is a critical process in breast cancer progression; however, its underlying mechanism remains to be elucidated. Here, we show that the water/glycerol channel protein aquaporin-3
Dieanira Erudaitius et al.
PloS one, 12(1), e0170442-e0170442 (2017-01-21)
Cancer cell toxicity to therapeutic H2O2 varies widely depending on cell type. Interestingly, it has been observed that different cancer cell types have varying peroxiporin expression. We hypothesize that variation in peroxiporin expression can alter cell susceptibility to therapeutic H2O2
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico