Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU068681

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGGAGGTCTATGAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAGAAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAACCTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATCATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCCCTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTGGAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCTGAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACA

Ensembl | human accession no.

ENSG00000120899

NCBI accession no.

NM_004103

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTK2B(2185) , PTK2B(2185)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chien-Chung Yang et al.
International journal of molecular sciences, 21(1) (2020-01-08)
Neuroinflammation is a landmark of neuroinflammatory and neurodegenerative diseases. Matrix metalloproteinase (MMP)-9, one member of MMPs, has been shown to contribute to the pathology of these brain diseases. Several experimental models have demonstrated that lipopolysaccharide (LPS) exerts a pathological role
Jialin Qian et al.
Oncology letters, 11(3), 1738-1744 (2016-03-22)
Lung cancer, specifically non-small cell lung cancer (NSCLC), is the leading cause of cancer-associated mortality in the world. In previous years, almost no significant advancements have been made towards the molecular characterization of NSCLC, which highlights the requirement for novel
Chih-Chung Lin et al.
Frontiers in molecular neuroscience, 10, 387-387 (2017-12-07)
Neurodegenerative disorders and brain damage are initiated by excessive production of reactive oxygen species (ROS), which leads to tissue injury, cellular death and inflammation. In cellular anti-oxidant systems, heme oxygenase-1 (HO-1) is an oxidative-sensor protein induced by ROS generation or
Qiaoqiao Wan et al.
Scientific reports, 7(1), 9033-9033 (2017-08-24)
Focal adhesion kinase (FAK) and Src family kinases (SFK) are known to play critical roles in mechanotransduction and other crucial cell functions. Recent reports indicate that they reside in different microdomains of the plasma membrane. However, little is known about
Pradip Das et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 181-192 (2020-12-06)
MCP-1-induced monocyte chemotaxis is a crucial event in inflammation and atherogenesis. Identifying the important signal transduction pathways that control monocyte chemotaxis can unravel potential targets for preventive therapies in inflammatory disease conditions. Previous studies have shown that the focal adhesion
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico