Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU062211

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Marshall Ellison et al.
Cell communication and signaling : CCS, 18(1), 15-15 (2020-01-29)
We have previously shown that the zinc finger transcription repressor SNAI2 (SLUG) represses tumor suppressor BRCA2-expression in non-dividing cells by binding to the E2-box upstream of the transcription start site. However, it is unclear how proliferating breast cancer (BC) cells
Gui-Nan Shen et al.
Molecular medicine reports, 17(6), 7827-7834 (2018-04-06)
High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated
Geoffroy Walbrecq et al.
Free radical biology & medicine, 84, 215-226 (2015-03-17)
Peroxiredoxin-5 (PRDX5) is a thioredoxin peroxidase that reduces hydrogen peroxide, alkyl hydroperoxides, and peroxynitrite. This enzyme is present in the cytosol, mitochondria, peroxisomes, and nucleus in human cells. Antioxidant cytoprotective functions have been previously documented for cytosolic, mitochondrial, and nuclear

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico