Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU061701

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFSF11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCA

Ensembl | nº de acceso humano

ENSG00000120659

Nº de acceso NCBI

NM_003701

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TNFSF11(8600) , TNFSF11(8600)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aase Haj Hensvold et al.
Arthritis research & therapy, 17, 239-239 (2015-09-05)
Receptor activator of nuclear factor kappa B ligand (RANKL) is a key regulator of bone metabolism. Anti-citrullinated protein antibodies (ACPA) have been suggested to cause bone destruction by osteoclast activation. We investigated the relationship between RANKL and ACPA in patients
Hae-Rim Kim et al.
PloS one, 10(4), e0124909-e0124909 (2015-04-22)
Vascular endothelial growth factor (VEGF) has angiogenic, inflammatory, and bone-destructive roles in rheumatoid arthritis (RA). We aimed to determine the unique role of VEGF in osteoclastogenesis in RA. VEGF-induced receptor activator of nuclear factor ҡB ligand (RANKL) expression was determined
Hong Hu et al.
Breast cancer research and treatment, 146(3), 515-523 (2014-07-11)
The receptor activator of nuclear factor-κB ligand (RANKL) acts as a paracrine factor in progesterone-induced mammary epithelial proliferation and tumorigenesis. This evidence comes mainly from mouse models. Our aim was to examine whether RANKL expression in human normal and malignant

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico