Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU043821

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1CC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGCCAAGATTCCACTGTTGGAGTGCCTAACCAGACATAGTTACAGAGAATGTTTGGGAAGACTGGATTCTTTACCTGAACATGAAGACTCAGAAAAAGCTGAGATGAAAAGATCCACTGAACTGGTGCTCTCTCCTGATATGCCTAGAACAACTAACGAATCTTTGTTAACCTCATTTCCCAAGTCAGTGGAACATGTGTCCCCAGATACCGCAGATGCTGAAAGTGGCAAAGAAATTAGGGAATCTTGTCAAAGTACTGTTCATCAGCAAGATGAAACTACGATTGACACTAAAGATGGTGATCTGCCCTTTTTTAATGTCTCTTTGTTAGACTGGATAAATGTTCAAGATAGACCTAATGATGTGGAATCTTTGGTCAGGAAGTGCTTTGATTCTATGAGCAGGCTTGATCCAAGGATTATTCGACCATTTATAGCAGAATGCCGTCAAACTATTGCC

Ensembl | human accession no.

ENSG00000023287

NCBI accession no.

NM_014781

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RB1CC1(9821) , RB1CC1(9821)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ingrid Kjos et al.
EMBO reports, 18(10), 1727-1739 (2017-08-25)
Autophagy (macroautophagy) is a highly conserved eukaryotic degradation pathway in which cytosolic components and organelles are sequestered by specialized autophagic membranes and degraded through the lysosomal system. The autophagic pathway maintains basal cellular homeostasis and helps cells adapt during stress;
Aykut Turan et al.
The Journal of cell biology, 218(2), 508-523 (2018-12-28)
Dendritic cells (DCs) are crucial for the induction of potent antiviral immune responses. In contrast to immature DCs (iDCs), mature DCs (mDCs) are not permissive for infection with herpes simplex virus type 1 (HSV-1). Here, we demonstrate that HSV-1 infection
Gaocai Li et al.
Cell death & disease, 11(2), 103-103 (2020-02-08)
N6 methyladenosine (m6A) is one of the most prevalent epitranscriptomic modifications of mRNAs, and plays a critical role in various bioprocesses. Bone-derived mesenchymal stem cells (BMSCs) can attenuate apoptosis of nucleus pulposus cells (NPCs) under compression; however, the underlying mechanisms
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to
Tomokazu Murakawa et al.
Cell reports, 26(2), 338-345 (2019-01-10)
Degradation of mitochondria by selective autophagy, termed mitophagy, contributes to the control of mitochondrial quality. Bcl2-L-13 is a mammalian homolog of Atg32, which is an essential mitophagy receptor in yeast. However, the molecular machinery involved in Bcl2-L-13-mediated mitophagy remains to
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico