Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU039071

Sigma-Aldrich

MISSION® esiRNA

targeting human AHR, RP11-507K12.1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTC

Ensembl | human accession no.

ENSG00000106546

NCBI accession no.

NM_001621

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AHR(196) , AHR(196)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yaxin Zhang et al.
Biomolecules & therapeutics, 25(2), 202-212 (2016-11-11)
Doxorubicin (DOX) is a highly effective chemotherapeutic agent; however, the dose-dependent cardiotoxicity associated with DOX significantly limits its clinical application. In the present study, we investigated whether Rb1 could prevent DOX-induced apoptosis in H9C2 cells
Collynn F Woeller et al.
The American journal of pathology, 186(12), 3189-3202 (2016-11-16)
Thyroid eye disease (TED) is a degenerative disease that manifests with detrimental tissue remodeling, myofibroblast accumulation, and scarring in the orbit of affected individuals. Currently, there are no effective therapies for TED that target or prevent the excessive tissue remodeling
J Gilbert et al.
Scientific reports, 10(1), 13978-13978 (2020-08-21)
We report that the naphthalimide analogue 2-(2-aminophenyl)-1H-benzo[de]isoquinoline-1,3(2H)-dione (NAP-6) is a highly potent and selective breast cancer targeting molecule. These effects are mediated via the aryl hydrocarbon receptor (AHR) pathway and the subsequent induction of CYP1 metabolising monooxygenases in breast cancer
Wen-Chih Liu et al.
International journal of molecular sciences, 21(20) (2020-10-15)
Indoxyl sulfate (IS), a uremic toxin derived from dietary tryptophan metabolism by the gut microbiota, is an endogenous aryl hydrocarbon receptor (AhR) agonist and a key player in bone remodeling. Resveratrol (RSV), an AhR antagonist, plays a protective role in
Babak Memari et al.
Scientific reports, 9(1), 8486-8486 (2019-06-13)
Links between solar UV exposure and immunity date back to the ancient Greeks with the development of heliotherapy. Skin contains several UV-sensitive chromophores and exposure to sunlight can produce molecules, such as vitamin D3, that act in an endocrine manner.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico