Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU032191

Sigma-Aldrich

MISSION® esiRNA

targeting human GSDMD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTTCTGGAAACCCCGTTATAAGTGTGTCAACCTGTCTATCAAGGACATCCTGGAGCCGGATGCCGCGGAACCAGACGTGCAGCGTGGCAGGAGCTTCCACTTCTACGATGCCATGGATGGGCAGATACAGGGCAGCGTGGAGCTGGCAGCCCCAGGACAGGCAAAGATCGCAGGCGGGGCCGCGGTGTCTGACAGCTCCAGCACCTCAATGAATGTGTACTCGCTGAGTGTGGACCCTAACACCTGGCAGACTCTGCTCCATGAGAGGCACCTGCGGCAGCCAGAACACAAAGTCCTGCAGCAGCTGCGCAGCCGCGGGGACAACGTGTACGTGGTGACTGAGGTGCTGCAGACACAGAAGGAGGTGGAAGTCACGCGCACCCACAAGCGGGAGGGCTCGGGCCGGTTTTCCCTGCCCGGAGCCACGTGCTTGCAGGGTGAGGGCCAGGGCCATCTGAGCCAGAAGAAGACGGTC

Ensembl | human accession no.

ENSG00000104518

NCBI accession no.

NM_024736

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GSDMD(79792) , GSDMD(79792)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianwei Gao et al.
Oncology reports, 40(4), 1971-1984 (2018-08-15)
Gasdermin D (GSDMD) is a newly discovered pyroptosis executive protein, which can be cleaved by inflammatory caspases and is essential for secretion of IL‑1β, making it a critical mediator of inflammation. However, the precise role of GSDMD in carcinogenesis remains nearly
Wenyi Zhao et al.
Experimental eye research, 202, 108375-108375 (2020-12-07)
The protein GSDMD is an important performer of pyroptosis and a universal substrate for the inflammatory caspase. However, the role and regulatory mechanism of GSDMD in Aspergillus fumigatus keratitis is remains unknown. Here we detected GSDMD protein in the cornea
Guangxue Gu et al.
International immunopharmacology, 91, 107227-107227 (2020-12-29)
Ankylosing spondylitis (AS) is a disease characterized by inflammation of the sacroiliac joint and the attachment point of the spine. This study aimed to investigate the effect of microRNA (miR)-204-targeted GSDMD on fibroblast-like synoviocytes (FLSs) in AS. miR-204, GSDMD, pyrolysis-related
Hui Chen et al.
Molecular neurodegeneration, 15(1), 26-26 (2020-04-17)
Acute glaucoma, characterized by a sudden elevation in intraocular pressure (IOP) and retinal ganglion cells (RGCs) death, is a major cause of irreversible blindness worldwide that lacks approved effective therapies, validated treatment targets and clear molecular mechanisms. We sought to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico