Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU028011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC2A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTCACTGTCGTGTCGCTGTTTGTGGTGGAGCGAGCAGGCCGGCGGACCCTGCACCTCATAGGCCTCGCTGGCATGGCGGGTTGTGCCATACTCATGACCATCGCGCTAGCACTGCTGGAGCAGCTACCCTGGATGTCCTATCTGAGCATCGTGGCCATCTTTGGCTTTGTGGCCTTCTTTGAAGTGGGTCCTGGCCCCATCCCATGGTTCATCGTGGCTGAACTCTTCAGCCAGGGTCCACGTCCAGCTGCCATTGCCGTTGCAGGCTTCTCCAACTGGACCTCAAATTTCATTGTGGGCATGTGCTTCCAGTATGTGGAGCAACTGTGTGGTCCCTACGTCTTCATCATCTTCACTGTGCTCCTGGTTCTGTTCTTCATCTTCACCTACTTCAAAGTTCCTGAGACTAAAGGCCGGACCTTCGATGAGATCGCTTCCGGCTTCCGGCAGGGGGGAGCCAGCCAAAGTGACAAGACACCCGAGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohui Wei et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 54, 120-131 (2019-01-23)
Emerging hallmark of cancer is reprogrammed cellular metabolism, increased glycolytic metabolism is physiological characteristic of human malignant neoplasms. Saponin monomer 13 of the dwarf lilyturf tuber (DT-13) is the main steroidal saponin from Liriopes Radix, which has been reported to
Sarka Tumova et al.
Vascular pharmacology, 87, 219-229 (2016-11-09)
Endothelial cells are routinely exposed to elevated glucose concentrations post-prandially in healthy individuals and permanently in patients with metabolic syndrome and diabetes, and so we assessed their sugar transport capabilities in response to high glucose. In human umbilical vein (HUVEC)
Huanyu Zhao et al.
Journal of Cancer, 10(20), 4989-4997 (2019-10-11)
Background: Glucose transporter 1 (GLUT1) is the main factor of Warburg effect, which is associated with poor prognosis in many tumors. However, the underlying molecular mechanism of GLUT1 in the progression of non-small cell lung cancer (NSCLC) is unclear. Methods:
Li-Fang Shen et al.
OncoTargets and therapy, 13, 11221-11235 (2020-11-12)
The alteration of tumor immunity after radiotherapy (RT) has been widely studied in recent years. However, the mechanism through which RT mediates tumor immunity and the involvement of glycolysis in this mediation in hypopharyngeal cancer remain unclear. This study investigated
Hongshuo Zhang et al.
Frontiers in physiology, 11, 543148-543148 (2020-10-27)
Successful embryo implantation requires receptive endometrium, which is conducive to the process of embryo recognition, adhesion, and invasion within a certain period of time and is inseparable from the dynamic interaction between 17β-estradiol (E2) and progesterone (P4). Proper glucose metabolism

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico