Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU018301

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARGC1A (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTTCAAACATATTTGAGAAGATAGATGAAGAGAATGAGGCAAACTTGCTAGCAGTCCTCACAGAGACACTAGACAGTCTCCCTGTGGATGAAGACGGATTGCCCTCATTTGATGCGCTGACAGATGGAGACGTGACCACTGACAATGAGGCTAGTCCTTCCTCCATGCCTGACGGCACCCCTCCACCCCAGGAGGCAGAAGAGCCGTCTCTACTTAAGAAGCTCTTACTGGCACCAGCCAACACTCAGCTA

Ensembl | human accession no.

ENSG00000109819

NCBI accession no.

NM_013261

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPARGC1A(10891) , PPARGC1A(10891)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

PPARGC1A (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional regulator which plays a key role in insulin signaling and mitochondrial regulation. It controls metabolism in many organs. For instance, it regulates gluconeogenesis in hepatocytes, thermogenesis in brown adipose tissue, and mitochondrial biogenesis and fatty acid oxidation in the heart. PPARGC1A also attenuates oxidative damage. Mutations in this gene are associated with type 2 diabetes mellitus. It is downregulated in prostate cancer. Presence of PPARGC1A inhibits prostate cancer progression and metastasis. However, presence of this protein gives selective advantages in breast cancer and melanoma cells.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

PGC-1a, glucose metabolism and type 2 diabetes mellitus.
Wu H
The Journal of Endocrinology, 229, R99-R99 (2016)
Xiao-Xia Zhang et al.
Cell biochemistry and function, 38(5), 549-557 (2020-02-11)
Neuregulin-1 (NRG-1)/erythroblastic leukaemia viral oncogene homologues (ErbB) pathway activation plays a crucial role in regulating the adaptation of the adult heart to physiological and pathological stress. In the present study, we investigate the effect of recombined human NRG-1 (rhNRG-1) on
The metabolic co-regulator PGC1a suppresses prostate cancer metastasis.
Torrano V, et. al.
Nature Cell Biology, 18, 645-645 (2016)
Lack of direct evidence for natural selection at the candidate thrifty gene locus, PPARGC1A.
Cadzow M
BMC Medical Genetics, 17, 80-80 (2016)
Jung Hyun Park et al.
FEBS open bio, 11(1), 61-74 (2020-08-30)
Several studies have indicated that cholestatic liver damage involves mitochondria dysfunction. However, the precise mechanism by which hydrophobic bile salts cause mitochondrial dysfunction is not clear. In this study, we intended to determine the pathogenesis of cholestatic liver injury associated
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico