Saltar al contenido
Merck

EHU002571

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC16A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCCTTGAGAAAGCTGGAAAATCTGGTGTGAAAAAAGATCTGCATGATGCAAATACAGATCTTATTGGAAGACACCCTAAACAAGAGAAACGATCAGTCTTCCAAACAATTAATCAGTTCCTGGACTTAACCCTATTCACCCACAGAGGCTTTTTGCTATACCTCTCTGGAAATGTGATCATGTTTTTTGGACTCTTTGCACCTTTGGTGTTTCTTAGTAGTTATGGGAAGAGTCAGCATTATTCTAGTGAGAAGTCTGCCTTCCTTCTTTCCATTCTGGCTTTTGTTGACATGGTAGCCCGACCATCTATGGGACTTGTAGCCAACACAAAGCCAATAAGACCTCGAATTCAGTATTTCTTTGCGGCTTCCGTTGTTGCAAATGGAGTGTGTCATATGCTAGCACCTTTATCCACTACCTATGTTGGATTCTGTGTCTATGCGGGATTCTTTGGATTTGCCTTCGGGTGGCTCAGCTCCGTATTGTTTGAAACATTGATGGACCTTGTTGGACCCCAGAGGTTCTCCAGCGCTGTGGGATTGGTGACCATTGTGGAATGCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

C J De Saedeleer et al.
Oncogene, 33(31), 4060-4068 (2013-10-30)
The glycolytic end-product lactate is a pleiotropic tumor growth-promoting factor. Its activities primarily depend on its uptake, a process facilitated by the lactate-proton symporter monocarboxylate transporter 1 (MCT1). Therefore, targeting the transporter or its chaperon protein CD147/basigin, itself involved in
Jae Hoon Jeong et al.
Scientific reports, 8(1), 6672-6672 (2018-04-29)
Release of fatty acids from lipid droplets upon activation of the sympathetic nervous system (SNS) is a key step in nonshivering thermogenesis in brown adipose tissue (BAT). However, intracellular lipolysis appears not to be critical for cold-induced thermogenesis. As activation
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico