Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU053261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rapgef3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCTTTGAACCACACAGCAAGGCAGGAACTGTGTTGTTCAGCCAGGGGGACAAGGGTACCTCGTGGTACATTATCTGGAAGGGATCTGTCAATGTGGTGACCCATGGCAAGGGGCTGGTGACCACGTTGCACGAGGGAGATGACTTTGGACAGCTGGCTCTGGTGAACGACGCACCTCGGGCAGCCACCATCATCCTTCGAGAAAATAACTGTCACTTTCTGCGTGTGGACAAGCAGGACTTCAACCGCATCATCAAGGATGTGGAAGCAAAAACCATGAGACTGGAAGAACACGGCAAAGTGGTCTTAGTTCTGGAGAGAACCTCTCAGGGTGCTGGCCCTTCCCGTCCCCCGACCCCAGGCAGGAACCGGTATACGGTCATGTCTGGCACCCCAGAGAAAATCCTAGAACTGCTGTTGGAGGCTATGAGACCGGATTCCAGTGCTCATGACCCAACAG

Ensembl | mouse accession no.

ENSMUSG00000022469

NCBI accession no.

NM_144850

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... RAPGEF3(223864) , Rapgef3(223864)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously
Ke Ke et al.
PloS one, 10(5), e0124869-e0124869 (2015-05-21)
Cilostazol has been reported to alleviate the metabolic syndrome induced by increased intracellular adenosine 3',5'-cyclic monophosphate (cAMP) levels, which is also associated with osteoclast (OC) differentiation. We hypothesized that bone loss might be attenuated via an action on OC by
Supachoke Mangmool et al.
Molecular endocrinology (Baltimore, Md.), 29(4), 583-596 (2015-02-27)
Although the cardioprotective effects of glucagon-like peptide-1 and its analogs have been reported, the exact mechanisms of the glucagon-like peptide-1 receptor (GLP-1R) signaling pathway in the heart are still unclear. Activation of the GLP-1R has been shown to increase cAMP
Pablo Muñoz-Llancao et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(32), 11315-11329 (2015-08-14)
Acquisition of neuronal polarity is a complex process involving cellular and molecular events. The second messenger cAMP is involved in axonal specification through activation of protein kinase A. However, an alternative cAMP-dependent mechanism involves the exchange protein directly activated by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico