Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU068551

Sigma-Aldrich

MISSION® esiRNA

targeting human YTHDF2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTGAGTCCACAGGCAAGGCCCAATAATGCATATACTGCCATGTCAGATTCCTACTTACCCAGTTACTACAGTCCCTCCATTGGCTTCTCCTATTCTTTGGGTGAAGCTGCTTGGTCTACGGGGGGTGACACAGCCATGCCCTACTTAACTTCTTATGGACAGCTGAGCAACGGAGAGCCCCACTTCCTACCAGATGCAATGTTTGGGCAACCAGGAGCCCTAGGTAGCACTCCATTTCTTGGTCAGCATGGTTTTAATTTCTTTCCCAGTGGGATTGACTTCTCAGCATGGGGAAATAACAGTTCTCAGGGACAGTCTACTCAGAGCTCTGGATATAGTAGCAATTATGCTTATGCACCTAGCTCCTTAGGTGGAGCCATGATTGATGGACAGTCAGCTTTTGCCAATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chuanzhao Zhang et al.
Oncogene, 39(23), 4507-4518 (2020-05-06)
N6-methyladenosine (m6A) RNA methylation contributes to the cancer stem cell (CSC) phenotype through regulating gene expression. YTHDF2, an m6A reader, was shown to be associated with hepatocellular carcinoma (HCC) patient prognosis. However, the effect of YTHDF2 on liver CSC and
Sara Zaccara et al.
Cell, 181(7), 1582-1595 (2020-06-04)
N6-methyladenosine (m6A) is the most abundant mRNA nucleotide modification and regulates critical aspects of cellular physiology and differentiation. m6A is thought to mediate its effects through a complex network of interactions between different m6A sites and three functionally distinct cytoplasmic
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Ye Fu et al.
Nature chemical biology, 16(9), 955-963 (2020-05-27)
Diverse RNAs and RNA-binding proteins form phase-separated, membraneless granules in cells under stress conditions. However, the role of the prevalent mRNA methylation, m6A, and its binding proteins in stress granule (SG) assembly remain unclear. Here, we show that m6A-modified mRNAs
Gaocai Li et al.
Cell death & disease, 11(2), 103-103 (2020-02-08)
N6 methyladenosine (m6A) is one of the most prevalent epitranscriptomic modifications of mRNAs, and plays a critical role in various bioprocesses. Bone-derived mesenchymal stem cells (BMSCs) can attenuate apoptosis of nucleus pulposus cells (NPCs) under compression; however, the underlying mechanisms

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico