Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU067421

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTACTGCAACAGCAGCTTTCAGCTTCAGGCAGATGGCAAGACCTGCAAAGATTTTGATGAGTGCTCAGTGTACGGCACCTGCAGCCAGCTATGCACCAACACAGACGGCTCCTTCATATGTGGCTGTGTTGAAGGATACCTCCTGCAGCCGGATAACCGCTCCTGCAAGGCCAAGAACGAGCCAGTAGACCGGCCCCCTGTGCTGTTGATAGCCAACTCCCAGAACATCTTGGCCACGTACCTGAGTGGGGCCCAGGTGTCTACCATCACACCTACGAGCACGCGGCAGACCACAGCCATGGACTTCAGCTATGCCAACGAGACCGTATGCTGGGTGCATGTTGGGGACAGTGCTGCTCAGACGCAGCTCAAGTGTGCCCGCATGCCTGGCCTAAAGGGCTTCGTGGATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianhua Peng et al.
Redox biology, 21, 101121-101121 (2019-02-01)
White matter injury (WMI) is associated with motor deficits and cognitive dysfunctions in subarachnoid hemorrhage (SAH) patients. Therapeutic strategy targeting WMI would likely improve the neurological outcomes after SAH. Low-density lipoprotein receptor-related protein-1 (LRP1), a scavenger receptor of apolipoprotein E
Ling Lin et al.
Oncotarget, 8(50), 88094-88103 (2017-11-21)
Macrophage accumulation is one of the hallmarks of progressive kidney disease. In response to injury, macrophages undergo a phenotypic polarization to become two functionally distinct subsets: M1 and M2 macrophages. Macrophage polarization is a dynamic process, and recent work indicates
Paola Merino et al.
The Journal of biological chemistry, 292(7), 2741-2753 (2016-12-18)
Axonal injury is a common cause of neurological dysfunction. Unfortunately, in contrast to axons from the peripheral nervous system, the limited capacity of regeneration of central nervous system (CNS) axons is a major obstacle for functional recovery in patients suffering
Aline Appert-Collin et al.
Cell adhesion & migration, 11(4), 316-326 (2016-07-28)
The low-density lipoprotein receptor-related protein-1 (LRP-1) is a member of Low Density Lipoprotein Receptor (LDLR) family, which is ubiquitously expressed and which is described as a multifunctional endocytic receptor which mediates the clearance of various extracellular matrix molecules including serine
Masayuki Nakano et al.
Disease models & mechanisms, 9(12), 1473-1481 (2016-12-10)
Helicobacter pylori, a major cause of gastroduodenal diseases, produces vacuolating cytotoxin (VacA) and cytotoxin-associated gene A (CagA), which seem to be involved in virulence. VacA exhibits pleiotropic actions in gastroduodenal disorders via its specific receptors. Recently, we found that VacA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico