Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

HMI0434

Sigma-Aldrich

MISSION® microRNA Mimic

hsa-miR-29a

Sinonimo/i:

hsa-miR-29a-3p

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
12352200
ID miRNA:
hsa-mir-29a Sanger Database
NACRES:
NA.51

Nome Commerciale

MISSION®

Forma fisica

solid

Sequenza matura

UAGCACCAUCUGAAAUCGGUUA

N° accesso Sanger maturo/minor

MIMAT0000086

N° accesso Sanger microRNA

MI0000087

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Altre note

miRBase V18 Mature ID update: hsa-miR-29a-3p

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

11 - Combustible Solids

Classe di pericolosità dell'acqua (WGK)

WGK 3

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mengxing Ouyang et al.
Scientific reports, 7, 44757-44757 (2017-03-21)
Successful developments of new therapeutic strategies often rely on the ability to deliver exogenous molecules into cytosol. We have developed a versatile on-chip vortex-assisted electroporation system, engineered to conduct sequential intracellular delivery of multiple molecules into various cell types at
Minfei Jin et al.
Stem cell research & therapy, 7(1), 167-167 (2016-11-20)
Pelvic floor dysfunction (PFD) is a condition affecting many women worldwide, with symptoms including stress urinary incontinence (SUI) and pelvic organ prolapse (POP). We have previously demonstrated stable elastin-expressing bone marrow-derived mesenchymal stem cells (BMSCs) attenuated PFD in rats, and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.