Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU036041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ripk1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGATGCACGTGCTAAAGACCCAGATAGATGTCCCACTTTCATTGAAAGGAAGGATAATCGTGGAGGCCATAGAAGGCATGTGCTACTTACATGACAAAGGTGTGATACACAAGGACCTGAAGCCTGAGAATATCCTCGTTGATCGTGACTTTCACATTAAGATAGCCGATCTTGGTGTGGCTTCCTTTAAGACATGGAGCAAACTGACTAAGGAGAAAGACAACAAGCAGAAAGAAGTGAGCAGCACCACTAAGAAGAACAATGGTGGTACCCTTTACTACATGGCACCCGAACACCTGAATGACATCAATGCAAAGCCCACGGAGAAGTCGGACGTGTACAGCTTTGGCATTGTCCTTTGGGCAATATTTGCAAAAAAGGAGCCCTATGAGAATGTCATCTGTACTGAGCAGTTCGTGATCTGCATAAAATCTGGGAACAGGCCAAATGTAGAGGAAATCCTTGAGTACTGTCCAAGGGAGATCATCAGC

N° accesso Ensembl | topo

ENSMUSG00000021408

N° accesso NCBI

NM_009068

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... RIPK1(19766) , Ripk1(19766)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via
Pedram Kharaziha et al.
Oncotarget, 6(35), 37066-37082 (2015-09-30)
Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.