Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU015011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACGATGGCACCTTTATTGGCTACAAGGAACGGCCTCAGGATGTGGATCAGCGAGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGCCAGCTGATGAAGACAGAGCGGCCAAGGCCCAACACCTTTATCATCCGCTGCCTGCAGTGGACCACAGTCATTGAGCGCACCTTCCATGTGGAAACGCCTGAGGAGCGGGAAGAATGGGCCACCGCCATTCAGACTGTGGCCGATGGACTCAAGAGGCAGGAAGAAGAGACGATGGACTTCCGATCAGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAACTACTGGGCAAGGGCACCTTTGGGAAAGTGATTCTGGTGAAAGAGAAGGCCACAGG

N° accesso Ensembl | topo

ENSMUSG00000001729

N° accesso NCBI

NP_033782

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... AKT1(11651) , Akt1(11651)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Lucía Barbier-Torres et al.
Oncotarget, 6(4), 2509-2523 (2015-02-05)
The current view of cancer progression highlights that cancer cells must undergo through a post-translational regulation and metabolic reprogramming to progress in an unfriendly environment. In here, the importance of neddylation modification in liver cancer was investigated. We found that
Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Tsung-Chieh Lin et al.
The Journal of pathology, 237(1), 50-61 (2015-05-01)
Ghrelin is an appetite-regulating molecule that promotes growth hormone (GH) release and food intake through growth hormone secretagogue receptor (GHS-R). Recently, high ghrelin levels have been detected in various types of human cancer. Ghrelin expression is observed in proximal and
Xiaozhan Zhang et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 34, 415-422 (2015-06-13)
Viral infections activate many host signaling pathways, including the phosphatidylinositol 3-kinase (PI3K)/Akt pathway, which has recently attracted considerable interest due to its central role in modulating virus replication. This study demonstrated that the sero-type 3 reovirus strain Masked Palm Civet/China/2004
J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.