Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU155151

Sigma-Aldrich

MISSION® esiRNA

targeting human EP300

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGCTTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGAGGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAATTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATTATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCAGGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGACTACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAATTGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Mizuo Ando et al.
Nature communications, 10(1), 2188-2188 (2019-05-18)
Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation outside the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks
Alexander Ring et al.
BMC cancer, 20(1), 1076-1076 (2020-11-11)
Triple negative breast cancer (TNBC) is an aggressive breast cancer subtype with basal features, lacking the expression of receptors targeted successfully in other breast cancer subtypes. Treatment response to adjuvant and neoadjuvant chemotherapy is often short-lived and metastatic spread occurs
Jia Tao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 1727-1733 (2018-08-19)
Pulmonary fibrosis is strongly correlated with inflammation factors, cytokine, and collagen secretion, whereby discoidin domain receptor 1 (DDR1) signaling plays an important role. EP300 is defined as an acetyltransferase that can acetylate histone and has been broadly studied in several
Karen Dendoncker et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(26), 12942-12951 (2019-06-12)
Glucocorticoid resistance (GCR) is defined as an unresponsiveness to the therapeutic effects, including the antiinflammatory ones of glucocorticoids (GCs) and their receptor, the glucocorticoid receptor (GR). It is a problem in the management of inflammatory diseases and can be congenital
Howard E Boudreau et al.
Oncotarget, 8(27), 44379-44397 (2017-06-03)
Previously, we showed wild-type (WT) and mutant (mut) p53 differentially regulate reactive oxygen species (ROS) generation by NADPH oxidase-4 (NOX4): p53-WT suppresses TGFβ-induced NOX4, ROS and cell migration, whereas tumor-associated mut-p53 proteins enhance NOX4 expression and cell migration. Here, we

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.