Passa al contenuto
Merck
Tutte le immagini(2)

Documenti

EHU135281

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(2)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC

N° accesso Ensembl | uomo

ENSG00000171791

N° accesso NCBI

NM_000633

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BCL2(596) , BCL2(596)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Tian-Quan Yang et al.
OncoTargets and therapy, 10, 4305-4313 (2017-09-19)
Glioma is one of the most common types of adult primary brain tumors, and the underlying molecular mechanisms still remain unclear. Nuclear factor-kappa B1 (NF-κB1) is involved in a variety of malignancies and is widely expressed in malignant tumors. However
Ya'nan Yang et al.
OncoTargets and therapy, 12, 897-906 (2019-02-19)
Peritoneal metastasis is the most common pathway for the spread of ovarian cancer. Ovarian cancer cells in ascites prefer to aggregate into the more chemoresistant multicellular spheroids (MCSs), leading to treatment failure and disease recurrence. We previously established a suspension
Gui-Yun Xu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 95-107 (2017-05-23)
Gastric cancer still presents a significant problem for public health worldwide. Troxerutin (TXN), a flavonoid present in tea, coffee, cereal grains, and a variety of fruits and vegetables, exhibits various pharmacological and biological activities in vitro and in vivo. We
Donghai Zhuang et al.
Oncology research, 28(4), 399-408 (2020-04-11)
miRNAs play an important role in progression of hepatocellular carcinoma (HCC). In this work, we assessed the function of miR-202 in human HCC and identified BCL2 as its target. We found miR-202 expression was found significantly downregulated, while BCL2 expression
Jianxu Zhang et al.
International journal of nanomedicine, 12, 4721-4732 (2017-07-26)
Herein, DNA duplex was constructed through the hybridization of adenosine triphosphate (ATP)-responsive aptamer and its cDNA in which GC-rich motif could be used to load doxorubicin (DOX), and then, cationic polymer PEI25K was used as a carrier to simultaneously condense
Visualizza tutti i documenti correlati

Articoli

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.