Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU132581

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCAGGATGGGAAGAGAGAACTCACACAGATGGAAGAATCTTCTACATAAATCACAATATAAAAAGAACACAATGGGAAGATCCTCGGTTGGAGAATGTAGCAATAACTGGACCAGCAGTGCCCTACTCCAGGGATTACAAAAGAAAGTATGAGTTCTTCCGAAGAAAGTTGAAGAAGCAGAATGACATTCCAAACAAATTTGAAATGAAACTTCGCCGAGCAACTGTTCTTGAAGACTCTTACCGGAGAATTATGGGTGTCAAGAGAGCAGACTTCCTGAAGGCTCGACTGTGGATTGAGTTTGATGGTGAAAAGGGATTGGATTATGGAGGAGTTGCCAGAGAATGGTTCTTCCTGATCTCAAAGGAAATGTTTAACCCTTATTATGGGTTGTTTGAATATTCTGCTACGGACAATTATACCCTACAGATAAATCCAAACTCTGGATTGTGTAACGAAGATCACCTCTCTTACTTCAAGTTTATTGGTCGGGTAGC

N° accesso Ensembl | uomo

ENSG00000069869

N° accesso NCBI

NM_006154

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NEDD4(4734) , NEDD4(4734)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Seon-Ae Jeon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 14772-14783 (2019-11-07)
E3 ubiquitin ligases are involved in the regulation of oxidative stress-induced cell death. In this study, we investigated the role of neural precursor cell-expressed, developmentally down-regulated protein 4 (NEDD4) in regulation of hydrogen peroxide (H2O2)-induced cell proliferation and apoptosis in
Wu Wen et al.
Cell cycle (Georgetown, Tex.), 16(16), 1509-1514 (2017-07-27)
The neural precursor cell expressed developmentally downregulated protein 4 (NEDD4) plays a pivotal oncogenic role in various types of human cancers. However, the function of NEDD4 in bladder cancer has not been fully investigated. In the present study, we aim to
Shaoyan Feng et al.
Cell cycle (Georgetown, Tex.), 16(9), 869-878 (2017-04-06)
Nasopharyngeal carcinoma (NPC) is a highly invasive head-neck cancer derived from the nasopharyngeal epithelium, mainly prevalent in southern China and Southeast Asia. Radiotherapy and adjuvant cisplatin (DDP) chemotherapy are standard administrations applied in the treatment of NPC. However, resistance to
Qiong Lin et al.
Journal of cell science, 130(22), 3839-3850 (2017-10-13)
Our previous studies have shown that the HECT E3 ubiquitin ligase NEDD4 interacts with LC3 and is required for starvation and rapamycin-induced activation of autophagy. Here, we report that NEDD4 directly binds to SQSTM1 via its HECT domain and polyubiquitylates
Jin Zhang et al.
American journal of translational research, 11(6), 3461-3471 (2019-07-18)
Prostate cancer is the second most common malignancy among men and causes a myriad of health problem for males that are diagnosed with the cancer. Although the 5-year relative survival rate of prostate cancer patients has been significantly increased due
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.