Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU123831

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT3A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAATGACCTCTCCATCGTCAACCCTGCTCGCAAGGGCCTCTACGAGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGGAGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTGACAAGAGGGACATCTCGCGATTTCTCGAGTCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTCTGGGGTAACCTTCCCGGTATGAACAGGCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAGGATAGCCAAGTTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAG

N° accesso Ensembl | uomo

ENSG00000119772

N° accesso NCBI

NM_022552

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... DNMT3A(1788) , DNMT3A(1788)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS
XPS
BGS
NAS
VXR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xi Han et al.
Cell biology international, 45(1), 227-237 (2020-10-23)
Emerging evidence suggests that miR-143 plays an important role in the regulation of tumor sensitivity to chemotherapeutic agents. The study explores the underlying mechanism of miR-143 in reversing cisplatin resistance in ovarian cancer. The cisplatin-resistant ovarian cancer cell line A2780/CDDP
Yu Nomura et al.
Cells, tissues, organs, 207(3-4), 115-126 (2019-10-02)
Stem cells have essential applications in in vitro tissue engineering or regenerative medicine. However, there is still a need to understand more deeply the mechanisms of stem cell differentiation and to optimize the methods to control stem cell function. In
Li Zhang et al.
Cancer cell international, 20, 325-325 (2020-07-24)
Methylation of histone 3 at lysine 9 (H3K9) and DNA methylation are epigenetic marks correlated with genes silencing. The tumor microenvironment significantly influences therapeutic responses and clinical outcomes. The epigenetic-regulation mechanism of the costimulatory factors Tim-3 and galectin-9 in cervical
Anjin Wang et al.
Oncology letters, 21(4), 272-272 (2021-03-16)
Cervical cancer is the second most common gynecological malignancy. Accumulating evidence has suggested that microRNAs (miRNAs) are involved in the occurrence and development of cervical cancer. The present study aimed to investigate the function and underlying molecular mechanism of microRNA
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.