Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU113061

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE3A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCTGCTGCTGCTATGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAAATTAGGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAAGGGTCTACACCAGATTGCTCTCTAATGAAAAAATTGAAACTGCCTTTCTCAATGCACTTGTATATTTGTCACCTAACGTGGAATGTGACTTGACGTATCACAATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCTCCACAGTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCAGCCCAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAG

N° accesso Ensembl | uomo

ENSG00000114062

N° accesso NCBI

NM_130838

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... UBE3A(7337) , UBE3A(7337)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Fei Zhang et al.
Journal of orthopaedic surgery and research, 12(1), 103-103 (2017-07-07)
Osteosarcoma (OS) is one of the most common malignant tumors developed in the bone. EZH2 has been found to play pivotal roles in the development of various cancers. LncRNA-ANCR (anti-differentiation ncRNA) has been reported to interact with EZH2 and regulated
Imran Jamal et al.
Neurobiology of disease, 105, 99-108 (2017-06-04)
Angelman syndrome (AS) is a neurodevelopmental disorder characterized by severe intellectual and developmental disabilities. The disease is caused by the loss of function of maternally inherited UBE3A, a gene that exhibits paternal-specific imprinting in neuronal tissues. Ube3a-maternal deficient mice (AS
Tsubasa Munakata et al.
PLoS pathogens, 3(9), 1335-1347 (2007-10-03)
Hepatitis C virus (HCV) is a positive-strand RNA virus that frequently causes persistent infections and is uniquely associated with the development of hepatocellular carcinoma. While the mechanism(s) by which the virus promotes cancer are poorly defined, previous studies indicate that
Yanfei Li et al.
Acta biochimica et biophysica Sinica, 52(1), 58-63 (2019-11-05)
Cardiac hypertrophy is considered to be a leading factor in heart function-related deaths. In this study, we explored the potential mechanism underlying cardiac hypertrophy induced by isoproterenol. Our results showed that isoproterenol induced cardiac hypertrophy in AC16 cells, as reflected
Dohun Pyeon et al.
Viruses, 11(12) (2019-12-01)
Molecular basis of HIV-1 life cycle regulation has thus far focused on viral gene stage-specificity, despite the quintessence of post-function protein elimination processes in the virus life cycle and consequent pathogenesis. Our studies demonstrated that a key pathogenic HIV-1 viral
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.