Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU109691

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTATGAAGCCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAATGGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTCCAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGTCCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAACACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACTGTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAA

N° accesso Ensembl | uomo

ENSG00000044574

N° accesso NCBI

NM_005347

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HSPA5(3309) , HSPA5(3309)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Patricia Dauer et al.
Molecular oncology, 12(9), 1498-1512 (2018-05-09)
Chemoresistance is a major therapeutic challenge that plays a role in the poor statistical outcomes in pancreatic cancer. Unfolded protein response (UPR) is one of the homeostasis mechanisms in cancer cells that have been correlated with chemoresistance in a number
Hiroshi Kokubun et al.
International journal of molecular sciences, 21(2) (2020-01-16)
Preclinical studies have shown that exposure of the developing brain to inhalational anesthetics can cause neurotoxicity. However, other studies have claimed that anesthetics can exert neuroprotective effects. We investigated the mechanisms associated with the neurotoxic and neuroprotective effects exerted by
Haopeng Yang et al.
Oncotarget, 7(50), 83641-83656 (2016-11-16)
Pancreatic cancer is a highly aggressive malignancy, which is intrinsically resistant to current chemotherapies. Herein, we investigate whether bisdemethoxycurcumin (BDMC), a derivative of curcumin, potentiates gemcitabine in human pancreatic cancer cells. The result suggests that BDMC sensitizes gemcitabine by inducing
Kyung-Won Park et al.
Scientific reports, 7, 44723-44723 (2017-03-24)
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein
Chengyan Luo et al.
Oncology research, 25(8), 1341-1348 (2017-03-01)
Cervical cancer is among the most common cancers inflicting women worldwide. Understanding the pathological mechanisms of cervical cancer development is critical for identifying novel targets for cervical cancer treatment. MicroRNAs (miRs) have various roles in regulating cancer development. In this
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.