Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU068161

Sigma-Aldrich

MISSION® esiRNA

targeting human CD47

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCCTCTGGCCTCTAGGTAACCAGTTTAAATTGGTTCAGGGTGATAACTACTTAGCACTGCCCTGGTGATTACCCAGAGATATCTATGAAAACCAGTGGCTTCCATCAAACCTTTGCCAACTCAGGTTCACAGCAGCTTTGGGCAGTTATGGCAGTATGGCATTAGCTGAGAGGTGTCTGCCACTTCTGGGTCAATGGAATAATAAATTAAGTACAGGCAGGAATTTGGTTGGGAGCATCTTGTATGATCTCCGTATGATGTGATATTGATGGAGATAGTGGTCCTCATTCTTGGGGGTTGCCATTCCCACATTCCCCCTTCAACAAACAGTGTAACAGGTCCTTCCCAGATTTAGGGTACTTTTATTGATGGATATGTTTTCCTTTTATTCACATAACCCCTTGAAACCCTG

N° accesso Ensembl | uomo

ENSG00000196776

N° accesso NCBI

NM_198793

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CD47(961) , CD47(961)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Natasha M Rogers et al.
Kidney international, 90(2), 334-347 (2016-06-05)
Defects in renal tubular epithelial cell repair contribute to renal ischemia reperfusion injury, cause acute kidney damage, and promote chronic renal disease. The matricellular protein thrombospondin-1 and its receptor CD47 are involved in experimental renal ischemia reperfusion injury, although the
Hui Zhao et al.
Scientific reports, 6, 29719-29719 (2016-07-15)
CD47 is overexpressed in many human cancers, its level positively correlates with tumor invasion and metastasis. However, it is largely unknown whether CD47 overexpression drives metastasis and how CD47 lead to tumor metastasis in non-small cell lung cancer (NSCLC). In
Jing Li et al.
Experimental cell research, 388(1), 111811-111811 (2020-01-04)
Age-related macular degeneration is a progressive ocular disease that is the leading cause of vision loss among elderly. AMD usually is divided into two types: wet and dry AMD, which is linked with inflammation. Choroidal Neovascularization (CNV) formation or wet
Xuejian Liu et al.
Oncology research, 27(4), 415-422 (2018-01-13)
Cluster of differentiation 47 (CD47) overexpression is common in various malignancies. This study investigated whether CD47 promotes human glioblastoma invasion and, if so, the underlying mechanisms involved. CD47 expression was found to be stronger in tissues of patients with glioblastoma
Xifu Song et al.
Experimental and therapeutic medicine, 20(4), 3301-3309 (2020-08-29)
Treatment with cluster of differentiation 47 (CD47) monoclonal antibody has exhibited promising antitumor effects in various preclinical cancer models. However, its role in pancreatic ductal adenocarcinoma (PDAC) remains unclear. In the present study, the CD47 expression level was measured in
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.