Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU058011

Sigma-Aldrich

MISSION® esiRNA

targeting human DPP4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TATCCAAAGGCAGGAGCTGTGAATCCAACTGTAAAGTTCTTTGTTGTAAATACAGACTCTCTCAGCTCAGTCACCAATGCAACTTCCATACAAATCACTGCTCCTGCTTCTATGTTGATAGGGGATCACTACTTGTGTGATGTGACATGGGCAACACAAGAAAGAATTTCTTTGCAGTGGCTCAGGAGGATTCAGAACTATTCGGTCATGGATATTTGTGACTATGATGAATCCAGTGGAAGATGGAACTGCTTAGTGGCACGGCAACACATTGAAATGAGTACTACTGGCTGGGTTGGAAGATTTAGGCCTTCAGAACCTCATTTTACCCTTGATGGTAATAGCTTCTACAAGATCATCAGCAATGAAGAAGGTTACAGACACATTTGCTATTTCCAAATAGATAAAAAAGACTGCACATTTATTACAAAAGGCACCTGGGAAG

N° accesso Ensembl | uomo

ENSG00000197635

N° accesso NCBI

NM_001935

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... DPP4(1803) , DPP4(1803)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ahmed A Al-Qahtani et al.
Oncotarget, 8(6), 9053-9066 (2017-01-25)
Middle East Respiratory Syndrome Corona Virus (MERS-CoV) is transmitted via the respiratory tract and causes severe Acute Respiratory Distress Syndrome by infecting lung epithelial cells and macrophages. Macrophages can readily recognize the virus and eliminate it. MERS-CoV infects cells via
Toshihiro Okamoto et al.
Biochemical and biophysical research communications, 504(2), 491-498 (2018-09-11)
Malignant pleural mesothelioma (MPM) is an aggressive malignancy arising from mesothelial lining of pleura. It is associated with a poor prognosis, partly due to the lack of a precise understanding of the molecular mechanisms associated with its malignant behavior. In
Youichi Sato et al.
The Journal of endocrinology, 223(2), 133-142 (2014-08-15)
In a previous study, we demonstrated that dipeptidyl peptidase 4 (DPP4)-deficient rats were susceptible to reduced glomerular filtration rate as a result of streptozotocin (STZ)-induced diabetes. Therefore, we proposed that DPP4 might be responsible for the preservation of renal function.
David Diaz-Jimenez et al.
The Journal of biological chemistry, 295(10), 3213-3227 (2020-01-29)
Glucocorticoids are potent endogenous anti-inflammatory molecules, and their cognate receptor, glucocorticoid receptor (GR), is expressed in nearly all immune cells. Macrophages are heterogeneous immune cells having a central role in both tissue homeostasis and inflammation and also play a role

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.