Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU146171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccr5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAACCCCTAGGCTTAGTTAGGTTGAAATACCCATTGAGGAAACAGCAAATACAAAGGAAGAATAAAGAGTTTAGCCGGGAAGGTAGTCTCATTTTACAGCCGGAATATAATGTTATCTCAGGCTAGCATTTTGTTCCTGCCTTCAGACCTAAATCCTACCACACCGGGACTGTGAAACACCTGGATTATGAATCATGAGCCTGAGGTCTAGGAATAATAATAACGTTTGTGATTTTAGATGAGGGCTGTTTCCATAGTTTGAAGCCAGAACTTTATCATCTTGAGCAGAAGCTCCAAGAGATGAGGAAAGAGCACCAATTTTTCTCTAATTTACTTAGCAGTCATCATCTCTGGAAGATTCATTTTAGAAACAAGTTGTTGTGCCCCTCAGAAGCCATGAGAGTATAACGACTGCTCTCTGTGTTCCAGGCTGAGTATGAGGACTTCAGTCACACTTTCCAGATGGCTTCTCCACACAAACAATGCTAAGTTTGGCCATTTCAGAGGTTT

Numéro d'accès Ensembl | souris

ENSMUSG00000079227

Numéro d'accès NCBI

NM_009917

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CCR5(12774) , Ccr5(12774)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shen Pang et al.
PloS one, 9(5), e96445-e96445 (2014-05-17)
The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression.
S Y Lee et al.
Journal of dental research, 94(12), 1715-1723 (2015-09-12)
Tooth movement by application of orthodontic biophysical force primarily reflects the role of soluble molecules released from the periodontal ligament (PDL). Thus far, many factors have been reported to be involved in orthodontic tooth movement (OTM), but key molecules that
Lanfu Zhao et al.
Acta biochimica et biophysica Sinica, 47(11), 890-898 (2015-09-24)
Glioblastoma (GBM) is the most prevalent malignant primary brain tumor in adults and exhibits a spectrum of aberrantly aggressive phenotype. Tumor cell proliferation and invasion are critically regulated by chemokines and their receptors. Recent studies have shown that the chemokine

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique