Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU089831

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTTTACCAGAAGCGACCACTTGAGCAAACATCAGCGCACCCACGGGGAGCCAGGCCCGGGACCGCCCCCAAGTGGCCCTAAGGAGCTGGGGGAGGGTCGCAGCGTCGGGGAAGAAGAAGCCAATCAGCCGCCCCGATCTTCCACTTCGCCTGCACCCCCAGAAAAAGCCCACGGAGGCAGCCCAGAGCAGAGCAACCTGCTAGAGATCTGAGCCGGGTAGAGGAAGGTCTCCAGCTCCAGGGTCCTCTTGCCAGGCTCTCTTGGCGTGCTGGACCCATTGGTTGCCCCTCGCTCTCTCCTATTGCATGCTATACTCTGGGGGCTCTCTCTGTTCCCCTAGGCTATCTCCTTGCATGTCTCCTCAGTTCTTCTCTCTTTGTCAAGAGTCTTAGCCAAACTCCTCTCAGGCCTTTGCCAGTGCCTAGTTCCTATGCTCCGACCTCCTCAACTTTTTCTTCTCTGCCCCTGTTCTTCACAGCTTCCATCTGGCCTCACATCATTTTCTCATTAACTCGTTGCCATCTAATCTTTCTGCTTCCCAATCCTATTTGC

Numéro d'accès Ensembl | souris

ENSMUSG00000060284

Numéro d'accès NCBI

NM_130458

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... SP7(170574) , Sp7(170574)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ning Li et al.
Molecular therapy. Nucleic acids, 22, 971-980 (2020-12-01)
Calcific aortic valve disease (CAVD) is a common heart valve disease in aging populations, and aberrant osteogenic differentiation of valvular interstitial cells (VICs) plays a critical role in the pathogenesis of ectopic ossification of the aortic valve. miR-214 has been
Wen-lin Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1015-1025 (2015-06-27)
The relationship between the p38MAPK signaling pathway and osterix in osteogenic differentiation of BMMSCs subjected to intermittent stretching was investigated. BMMSCs derived from C57BL/6J mice were divided into the following groups: 1) control, 2) stretch, and 3) SB203580+stretch (SB203580 is
Y Zhang et al.
Oral diseases, 21(5), 583-592 (2015-02-05)
To understand the differences and similarities between immunocompetent and immunodeficient mice as ectopic transplantation animal models for bone tissue engineering. Osteogenic cells from mouse leg bones were cultured, seeded on β-TCP granules, and transplanted onto the backs of either immunocompetent

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique