Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU069661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Becn1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCAATAAGATGGGTCTGAAGTTTCAGAGGTACCGACTTGTTCCCTATGGAAATCATTCCTATCTGGAGTCTCTGACAGACAAATCTAAGGAGTTGCCGTTATACTGTTCTGGGGGTTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTAGCTTTTCTGGACTGTGTGCAGCAGTTCAAAGAAGAGGTGGAAAAAGGAGAGACTCGATTTTGTCTTCCGTACAGGATGGACGTGGAGAAAGGCAAGATTGAAGACACTGGAGGCAGTGGCGGCTCCTATTCCATCAAAACCCAGTTTAACTCGGAGGAGCAGTGGACAAAAGCGCTCAAGTTCATGCTGACCAATCTCAAGTGGGGTCTTGCCTGGGTGTCCTCACAGTTCTATAACAAGTGACTTGCTCCTTAGGGGATGTTTG

Numéro d'accès Ensembl | souris

ENSMUSG00000035086

Numéro d'accès NCBI

NM_019584

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... BECN1(56208) , Becn1(56208)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QDV
PQS
DES
AOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ge Niu et al.
The Journal of biological chemistry, 290(29), 18102-18110 (2015-06-10)
One of the fundamental functions of molecular chaperone proteins is to selectively conjugate cellular proteins, targeting them directly to lysosome. Some of chaperones, such as the stress-induced Hsp70, also play important roles in autophagosome-forming macroautophagy under various stress conditions. However
Yusra Al Dhaheri et al.
PloS one, 9(10), e109630-e109630 (2014-10-10)
In this study we investigated the in vitro and in vivo anticancer effect of carnosol, a naturally occurring polyphenol, in triple negative breast cancer. We found that carnosol significantly inhibited the viability and colony growth induced G2 arrest in the
Xing-guo Zhao et al.
PloS one, 10(4), e0126147-e0126147 (2015-04-30)
Hypopharyngeal squamous cell carcinoma (HSCC) has the worst prognosis among head and neck cancers. Cisplatin (DDP)-based chemotherapy is an important part of multimodal treatments. However, resistance to DDP severely impairs the effectiveness of chemotherapy for HSCC. Chloroquine (CQ) has been
Pujika Emani Munasinghe et al.
International journal of cardiology, 202, 13-20 (2015-09-20)
Diabetes promotes progressive loss of cardiac cells, which are replaced by a fibrotic matrix, resulting in the loss of cardiac function. In the current study we sought to identify if excessive autophagy plays a major role in inducing this progressive
Tiina Öhman et al.
Journal of immunology (Baltimore, Md. : 1950), 192(12), 5952-5962 (2014-05-09)
Dectin-1 is a membrane-bound pattern recognition receptor for β-glucans, which are the main constituents of fungal cell walls. Detection of β-glucans by dectin-1 triggers an effective innate immune response. In this study, we have used a systems biology approach to
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique