Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU043721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ephb4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCCATCAAGATGGGAAGATACGAGGAAAGTTTTGCAGCGGCTGGATTCGGCTCCTTTGAGGTGGTCAGTCAGATCTCTGCCGAGGACCTTCTCCGAATTGGAGTCACTCTGGCAGGACACCAGAAGAAAATCTTGGCCAGTGTGCAGCATATGAAGTCCCAAGCTAAGCCAGGAGCCCCTGGTGGGACAGGGGGACCAGCCCAGCAGTTCTGACCTCCAAGGACTCACCACCGTGGCAGATTCTTCTTTCCGGGAGGCAGAGTTGGGTGGGGACTCACAAGATGACCCCCTCCCCCTCGTCACAGCCTTCCCATTGGATTGCACTTTGAACAGAGGGGGTCGGAGACACAGGATTTGGGGAACCGTGCCATATGGGATCATACATGTGCCCTCCAGGCGGGGAACCCCAAACTCAGAGTGAGTCTTTCCCTCAAGACTGGGCAAAGAAACATCCCTACGTCTCTAACCTCCCATCTTCCCAGAGGGCTCTCTCCCCAAGCGCCTTCCACCTCAACGGGCATGTCCCTGCAGACCAAAGAGAAAGGGTGACCA

Numéro d'accès Ensembl | souris

ENSMUSG00000029710

Numéro d'accès NCBI

NM_001159571

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... EPHB4(13846) , Ephb4(13846)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Thao M Nguyen et al.
Stem cells (Dayton, Ohio), 33(9), 2838-2849 (2015-06-03)
The tyrosine kinase receptor, EphB4, mediates cross-talk between stromal and hematopoietic populations during bone remodeling, fracture repair and arthritis, through its interactions with the ligand, ephrin-B2. This study demonstrated that transgenic EphB4 mice (EphB4 Tg), over-expressing EphB4 under the control
Inga Mertens-Walker et al.
Experimental cell research, 333(1), 105-115 (2015-03-01)
The EphB4 receptor tyrosine kinase is over-expressed in a variety of different epithelial cancers including prostate where it has been shown to be involved in survival, migration and angiogenesis. We report here that EphB4 also resides in the nucleus of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique