Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU026301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nr1h4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGGAGGCCATGTTTCTTCGTTCGGCGGAGATTTTCAATAAGAAACTTCCTGCCGGACATGCAGACCTGTTGGAAGAAAGAATTCGAAAGAGTGGTATCTCTGATGAGTATATAACCCCGATGTTCAGTTTCTATAAAAGTGTTGGAGAACTCAAAATGACTCAGGAGGAGTACGCTCTGCTCACAGCGATCGTCATCCTCTCTCCAGACAGACAATACATCAAGGACAGAGAGGCGGTGGAGAAGCTGCAGGAGCCCCTGCTTGATGTGCTACAAAAGCTGTGCAAGATGTACCAGCCTGAGAACCCACAGCATTTCGCCTGCCTCCTGGGTCGCCTGACGGAACTCCGGACATTCAACCATCACCACGCTGAGATGCTGATGTCTTGGAGAGTGAATGATCACAAGTTCACCCCGCTCCTCTGTGAGATCTGGGATGTGCAGTGATGGACAC

Numéro d'accès Ensembl | souris

ENSMUSG00000047638

Numéro d'accès NCBI

NM_009108

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NR1H4(20186) , Nr1h4(20186)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular
Jialin He et al.
Molecular cancer, 14, 163-163 (2015-08-26)
microRNA-122 (miR-122) is the most abundant and specific miRNA in the liver. It acts as an important tumor suppressor in hepatocellular carcinoma (HCC) through regulating its target genes, but details of its own regulation are largely unknown. Farnesoid X receptor
Yan-Dong Wang et al.
Molecular endocrinology (Baltimore, Md.), 29(2), 322-331 (2014-12-17)
The farnesoid X receptor (FXR) is a key metabolic and homeostatic regulator in the liver. In the present work, we identify a novel role of FXR in antagonizing c-Jun N-terminal kinase (JNK) signaling pathway in liver carcinogenesis by activating superoxide

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique