Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU023861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nampt

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCACCGACTCGTACAAGGTTACTCACTATAAACAATACCCACCCAACACAAGCAAAGTTTATTCCTACTTTGAATGCCGTGAAAAGAAGACAGAAAACTCCAAAGTAAGGAAGGTGAAATACGAGGAAACAGTATTTTATGGGTTGCAGTACATTCTTAATAAGTACTTAAAAGGTAAAGTAGTGACCAAAGAGAAAATCCAGGAGGCCAAAGAAGTGTACAGAGAACATTTCCAAGATGATGTCTTTAACGAAAGAGGATGGAACTACATCCTTGAGAAATACGATGGTCATCTCCCGATTGAAGTAAAGGCTGTTCCCGAGGGCTCTGTCATCCCCAGAGGGAACGTGCTGTTCACAGTGGAAAACACAGACCCAGAGTGCTACTGGCTTACCAATTGGATTGAGACTATTCTTGTTCAGTCCTGGTATCCAATTACAGTGGCCACAA

Numéro d'accès Ensembl | souris

ENSMUSG00000020572

Numéro d'accès NCBI

NM_021524

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NAMPT(59027) , Nampt(59027)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xu He et al.
Experimental cell research, 352(1), 45-52 (2017-02-06)
Decreased bone volume and strength with aging and enhanced risk of fractures are in part due to reduced number of bone-forming mesenchymal stem cells (MSCs) and cellular dysfunction. In a previous study, we found that osteogenic differentiation of the multipotent
Min Ling et al.
Cell & bioscience, 7, 27-27 (2017-05-27)
Bone degenerative disorders like osteoporosis may be initiated by age-related shifts in anabolic and catabolic responses that control bone homeostasis. Although there are studies suggesting that metabolic changes occur with stem cell differentiation, the molecular mechanisms governing energy metabolism and
Xia Wang et al.
Scientific reports, 5, 12657-12657 (2015-08-01)
Nicotinamide phosphoribosyltransferase (NAMPT) is a promising antitumor target. Novel NAMPT inhibitors with diverse chemotypes are highly desirable for development of antitumor agents. Using high throughput screening system targeting NAMPT on a chemical library of 30000 small-molecules, we found a non-fluorescent
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique