Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU021811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fn1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGCTTCATGCCGCTAGATGTGCAAGCTGACAGAGACGATTCTCGAGAGTAATCTTTCCAGCCCCACCCTACAAGTGTCTCTCTACCAAGGTCAATCCACACCCCAGTGATGTTAGCAGACCCTCCATCTTTGAGTGGTCCTTTCACCCTTAAGCCTTTTGCTCTGGAGCCATGTTCTCAGCTTCAGCACAATTTACAGCTTCTCCAAGCATCGCCCCGTGGGATGTTTTGAGACTTCTCTCCTCAATGGTGACAGTTGGTCACCCTGTTCTGCTTCAGGGTTTCAGTACTGCTCAGTGTTGTTTAAGAGAATCAAAAGTTCTTATGGTTTGGTCTGGGATCAATAGGGAAACACAGGTAGCCAACTAGGAGGAAATGTACTGAATGCTAGTACCCAAGACCTTGAGCAGGAAAGTCACCCAGACACCTCTGCTTTCTTTTGCC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenjian Wang et al.
Kidney international, 81(10), 1002-1014 (2012-03-02)
Scavenger receptor A (SR-A) is a key transmembrane receptor in the endocytosis of lipids and contributes to the pathogenesis of atherosclerosis. To assess its role in hyperlipidemic chronic kidney disease, wild-type and SR-A-deficient (knockout) mice underwent uninephrectomy followed by either
H W Zhang et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 26-32 (2015-05-31)
Endothelial progenitor cells (EPCs) could function as niche cells to promote self—renewal of mesenchymal stem cells (MSCs) in the mouse bone marrow. Cohesion was the basis of the two cells to display their biological functions to each other. In this
Tong-Peng Xu et al.
Journal of hematology & oncology, 7, 63-63 (2014-08-30)
FENDRR is a long non-coding RNAs (lncRNA) that binds to polycomb repressive complexe 2 (PRC2) to epigenetically regulate the expression of its target gene. The clinical role of FENDRR in carcinomas remains yet to be found. Real-time polymerase chain reaction

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique