Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU223451

Sigma-Aldrich

MISSION® esiRNA

targeting human POU5F1 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGGTGATGGGCCAGGGGGGCCGGAGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGCTTCCAAGGCCCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGCGTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGGGCGAAGCAGGAG

Numéro d'accès Ensembl | humain

ENSG00000206454

Numéro d'accès NCBI

NM_203289

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... POU5F1(5460) , POU5F1(5460)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shaoheng Zhang et al.
Cell death & disease, 8(1), e2548-e2548 (2017-01-13)
Poor cell survival and limited functional benefits have restricted mesenchymal stem cell (MSC) efficacy for treating myocardial infarction (MI), suggesting that a better understanding of stem cell biology is needed. The transcription factor HIF-2α is an essential regulator of the
Axel R Göhring et al.
PloS one, 12(4), e0174912-e0174912 (2017-04-21)
Oct4 was reported to be one of the most important pluripotency transcription factors in the biology of stem cells including cancer stem cells, and progressed malignant cells. Here we report the investigation of gene expression control of Oct4 by selected
Lei Liu et al.
Biochemical and biophysical research communications, 461(3), 525-532 (2015-04-26)
Our previous study showed that Octamer-binding transcription factor 4 (OCT4) expression was upregulated and significantly associated with histological grade through the analysis of OCT4 expression in 159 ovarian cancer tissue samples, and OCT4 mediated follicle-stimulating hormone (FSH)-induced anti-apoptosis in epithelial
Sung-Jen Wei et al.
Cell death & disease, 11(5), 368-368 (2020-05-16)
Despite the improvement in clinical outcome with 13-cis-retinoic acid (13-cisRA) + anti-GD2 antibody + cytokine immunotherapy given in first response ~40% of high-risk neuroblastoma patients die of recurrent disease. MYCN genomic amplification is a biomarker of aggressive tumors in the
Pengmu Xie et al.
Experimental and molecular pathology, 108, 9-16 (2019-03-12)
Endometrial cancer (EC) is ranked as the most common gynecologic malignancy of the female genital tract and the fourth most common neoplasia in women. Accumulated evidences reveal that TRAF4 plays a critical role in the progress of various cancers, but
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique