Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU021051

Sigma-Aldrich

MISSION® esiRNA

targeting human MYC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuyang Wang et al.
World journal of gastroenterology, 23(18), 3252-3261 (2017-06-02)
To determine the role of hepatitis B virus X protein (HBx), HBx in regulating hepatic progenitor cell (HPC)-like features in hepatocellular carcinoma (HCC) and the underlying molecular mechanisms. We used a retrovirus vector to introduce wild type HBx or empty
Xiao-Lu Ma et al.
Journal of hematology & oncology, 13(1), 11-11 (2020-02-07)
Aberrant AKT activation contributes to cancer stem cell (CSC) traits in hepatocellular carcinoma (HCC). We previously reported that CD73 activated AKT signaling via the Rap1/P110β cascade. Here, we further explored the roles of CD73 in regulating CSC characteristics of HCC.
Feifei Zhang et al.
EBioMedicine, 44, 311-321 (2019-05-13)
Gastric cancer (GC) ranks the fifth most common cancer, and chemotherapy is one of the most common treatments for GC. However, chemoresistance limits the effectiveness of chemotherapy and leads to treatment failure. This study aims to investigate the biological effect
Yili Tao et al.
Scientific reports, 8(1), 14477-14477 (2018-09-29)
Colorectal cancer (CRC) is among the most frequently occurring cancers worldwide. Baicalin is isolated from the roots of Scutellaria baicalensis and is its dominant flavonoid. Anticancer activity of baicalin has been evaluated in different types of cancers, especially in CRC.
Juanjuan Liu et al.
Annals of biomedical engineering, 45(6), 1407-1419 (2017-03-30)
Melanoma is a potentially lethal skin cancer with high mortality rate. Recently, the peptide-mediated transdermal delivery of small interference RNA (siRNA) emerges as a promising strategy to treat melanoma by inducing the apoptosis of tumor cells, but the related theoretical

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique