Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU218961

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGAGTCACACCAGAAAGCTAGGTCGTGGGTCAGCTCTGAGGATGTATACCCCTGGTGGGAGAGGGAGACCTAGAGATCTGGCTGTGGGGCGGGCATGGGGGGTGAAGGGCCACTGGGACCCTCAGCCTTGTTTGTACTGTATGCCTTCAGCATTGCCTAGGAACACGAAGCACGATCAGTCCATCCCAGAGGGACCGGAGTTATGACAAGCTTTCCAAATATTTTGCTTTATCAGCCGATATCAACACTTGTATCTGGCCTCTGTGCCCCAGCAGTGCCTTGTGCAATGTGAATGTGCGCGTCTCTGCTAAACCACCATTTTATTTGGTTTTTGTTTTGTTTTGGTTTTGCTCGGATACTTGCCAAAATGAGACTCTCCGTCGGCAGCTGGGGGAAGGGTCTGAGACTCCCTTTCCTTTTGGTTTTGGGATTACTTTTGATCCTGGGGGACCAATGAGGTGAGGGGGGTTCTCCTTTGCCCTCAGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ana Rita Lourenço et al.
Nature communications, 11(1), 785-785 (2020-02-09)
Extracellular signals such as TGF-β can induce epithelial-to-mesenchymal transition (EMT) in cancers of epithelial origin, promoting molecular and phenotypical changes resulting in pro-metastatic characteristics. We identified C/EBPα as one of the most TGF-β-mediated downregulated transcription factors in human mammary epithelial
Wei Liu et al.
Respiratory research, 20(1), 281-281 (2019-12-13)
Fibroblasts regulate tissue homeostasis and the balance between tissue repair and fibrosis. CCAAT/enhancer-binding protein alpha (CEBPA) is a key transcription factor that regulates adipogenesis. CEBPA has been shown to be essential for lung maturation, and deficiency of CEBPA expression leads
Rui Su et al.
Cell, 172(1-2), 90-105 (2017-12-19)
R-2-hydroxyglutarate (R-2HG), produced at high levels by mutant isocitrate dehydrogenase 1/2 (IDH1/2) enzymes, was reported as an oncometabolite. We show here that R-2HG also exerts a broad anti-leukemic activity in vitro and in vivo by inhibiting leukemia cell proliferation/viability and by promoting

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique