Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU154031

Sigma-Aldrich

MISSION® esiRNA

targeting human PYGB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACTCGGAGATCGTGAAACAGTCGGTCTTTAAGGATTTTTATGAACTGGAGCCAGAGAAGTTCCAGAATAAGACCAATGGCATCACCCCCCGCCGGTGGCTGCTGCTGTGCAACCCGGGGCTGGCCGATACCATCGTGGAGAAAATTGGGGAGGAGTTCCTGACTGACCTGAGCCAGCTGAAGAAGCTGCTGCCGCTGGTCAGTGACGAGGTGTTCATCAGGGACGTGGCCAAGGTCAAACAGGAGAACAAGCTCAAGTTCTCGGCCTTCCTGGAGAAGGAGTACAAGGTGAAGATCAACCCCTCCTCCATGTTCGATGTGCATGTGAAGAGGATCCACGAGTACAAGCGGCAGCTGCTCAACTGCCTGCACGTCGTCACCCTGTACAATCGAATCAAGAGAGACCCGGCCAAGGCTTTTGTGCCCAGGACTGTTATGATTGGGGGCAAGGCAGCGCCCGGTTACCACATGGCCAAGCTGATCATCAAGTTGGTCACCTCCATCGGCGACGTCGTCAATCATGACCCAGTTGTGGGTGACAGGTTGAAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhen Wang et al.
Molecular medicine reports, 18(4), 3800-3808 (2018-08-15)
Brain‑type glycogen phosphorylase (PYGB) is an enzyme that metabolizes glycogen, whose function is to provide energy for an organism in an emergency state. The present study purposed to investigate the role and mechanism of PYGB silencing on the growth and
Liang Wang et al.
Technology in cancer research & treatment, 19, 1533033820905832-1533033820905832 (2020-02-08)
To explore the clinical value of ultrasound in the diagnosis of medullary thyroid carcinoma by comparing with enhanced computed tomography. This retrospective study was performed on 62 patients with pathologically confirmed medullary thyroid carcinoma. All patients underwent ultrasound and enhanced

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique