Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU153581

Sigma-Aldrich

MISSION® esiRNA

targeting human TESC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTACCATTCGCAAGGAGAACTTCAACAATGTCCCGGACCTGGAGCTCAACCCCATCCGATCCAAAATTGTTCGTGCCTTCTTCGACAACAGGAACCTGCGCAAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATGTCCTACTTCCGGCCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTGAGATTTCTGTTCCACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTAAAGTGGTCGAGGAGCTGCTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTC

Numéro d'accès Ensembl | humain

ENSG00000088992

Numéro d'accès NCBI

NM_017899

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TESC(54997) , TESC(54997)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ai-Jing Luo et al.
Experimental and molecular pathology, 107, 110-117 (2018-12-31)
Renal cell carcinoma (RCC) is the most common form of kidney cancer. Recent studies reported that Tescalcin was overexpressed in various tumor types. However, the status of Tescalcin protein expression in RCC and its biological function is uncertain. This study
Jieun Kang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13843-13853 (2016-08-04)
We reported previously that tescalcin (TESC) levels were higher in tissue and serum from colorectal cancer (CRC) patients and suggested that TESC was a potential oncotarget in CRC. The aim of this study was to investigate the function of TESC
Yun Hee Kang et al.
Oncotarget, 5(8), 2149-2160 (2014-05-09)
Tescalcin (TESC) is an EF-hand calcium binding protein that is differentially expressed in several tissues, however it is not reported that the expression and functional roles of TESC in colorectal cancer. Levels of messenger RNA (mRNA) and protein expression of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique