Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU147931

Sigma-Aldrich

MISSION® esiRNA

targeting human AREG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF


Check Cart for Availability


Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF


Check Cart for Availability

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAACTGAAGATAAAATTACAGGATATCACATTGGAGTCACTGCCAAGTCATAGCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian Wang et al.
Cellular signalling, 53, 122-131 (2018-10-07)
Ambient particulate matter (PM) promotes the development and exacerbation of chronic respiratory diseases, including chronic obstructive pulmonary disease (COPD) and asthma, by increasing inflammation and mucus hypersecretion. However, the biological mechanisms underlying PM-induced airway inflammation and mucus hypersecretion remain unclear.
Simona Taverna et al.
Scientific reports, 7(1), 3170-3170 (2017-06-11)
Non-small cell lung cancer (NSCLC) remains the leading cause of cancer-related deaths worldwide. The majority of patients are diagnosed in advanced disease stage. Bone metastasis is the most frequent complication in NSCLC resulting in osteolytic lesions. The perfect balance between
Shuntaro Tokunaga et al.
Anticancer research, 37(5), 2225-2231 (2017-05-10)
Amrubicin (AMR) has shown promising activity for lung cancer. However, little is known about the mechanism underlying resistance to this agent. The aim of this study was to elucidate the mechanism underlying resistance to AMR. We first developed amrubicinol (AMR-OH)-resistant
Yuanzhong Wang et al.
Endocrine-related cancer, 27(12), 671-683 (2020-10-29)
Acquired resistance to aromatase inhibitors (AIs) is a significant clinical issue in endocrine therapy for estrogen receptor (ER) positive breast cancer which accounts for the majority of breast cancer. Despite estrogen production being suppressed, ERα signaling remains active and plays
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique