Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU142651

Sigma-Aldrich

MISSION® esiRNA

targeting human RSAD2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGAGCAATGGAAGCCTGATCCGGGAGAGGTGGTTCCAGAATTATGGTGAGTATTTGGACATTCTCGCTATCTCCTGTGACAGCTTTGACGAGGAAGTCAATGTCCTTATTGGCCGTGGCCAAGGAAAGAAGAACCATGTGGAAAACCTTCAAAAGCTGAGGAGGTGGTGTAGGGATTATAGAGTCGCTTTCAAGATAAATTCTGTCATTAATCGTTTCAACGTGGAAGAGGACATGACGGAACAGATCAAAGCACTAAACCCTGTCCGCTGGAAAGTGTTCCAGTGCCTCTTAATTGAGGGTGAGAATTGTGGAGAAGATGCTCTAAGAGAAGCAGAAAGATTTGTTATTGGTGATGAAGAATTTGAAAGATTCTTGGAGCGCCACAAAGAAGTGTCCTGCTTGGTGCCTGAATCTAACCAGAAGATGAAAGACTCCTACCTTATTCTGGATGAATATATGCGCTTTCTGAACTGTAGAAAGGGACGGAAGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

B Wang et al.
Placenta, 36(6), 667-673 (2015-03-31)
Viperin, a virus-inducible antiviral protein, has been reported to inhibit the replication of a variety of viruses. However, its expression and function in trophoblast cells remains unclear. Toll-like receptor 3 (TLR3) is a key component of the innate immune system
Keaton M Crosse et al.
Immunology and cell biology, 99(4), 373-391 (2020-11-02)
Viperin is an interferon-inducible protein that is pivotal for eliciting an effective immune response against an array of diverse viral pathogens. Here we describe a mechanism of viperin's broad antiviral activity by demonstrating the protein's ability to synergistically enhance the
José R Peña Cárcamo et al.
Virology, 514, 216-229 (2017-12-05)
Junín arenavirus infections are associated with high levels of interferons in both severe and fatal cases. Upon Junín virus (JUNV) infection a cell signaling cascade initiates, that ultimately attempts to limit viral replication and prevent infection progression through the expression
Ji-Su Jang et al.
Cell death & disease, 9(8), 823-823 (2018-08-03)
Dendritic cells (DCs) are the most potent professional antigen presenting cells and inducers of T cell-mediated immunity. However, few specific markers of mature DCs (mDC) have been reported. A previous microarray analysis revealed expression of mDC-specific genes and identified Rsad2

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique