Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU139841

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCAGGACCAGTTTCCATAGACTGCGGACTGGGGTCTTCCTCCAGCAGTTACTTGATGCCCCCTCCCCCGACACAGACTCTCAATCTGCCGGTGGTAAGAACCGGTTCTGAGCTGGCGTCTGAGCTGCTGCGGGGTGGAAGTGGGGGGCTGCCCACTCCACTCCTCCCATCCCCTCCCAGCCTCCTCCTCCGGCAGGAACTGAACAGAACCACAAAAAGTCTACATTTATTTAATATGATGGTCTTTGCAAAAAGGAACAAAACAACACAAAAGCCCACCAGGCTGCTGCTTTGTGGAAAGACGGTGTGTGTCGTGTGAAGGCGAAACCCGGTGTACATAACCCCTCCCCCTCCGCCCCGCCCCGCCCGGCCCCGTAGAGTCCCTGTCGCCCGCCGGCCCTGCCTGTAGATACGCCCCGCTGTCTGTGCTGTGAGAGTCGC

Numéro d'accès Ensembl | humain

ENSG00000075891

Numéro d'accès NCBI

NM_000278

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PAX2(5076) , PAX2(5076)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Imlimaong Aier et al.
PloS one, 14(10), e0223554-e0223554 (2019-10-18)
Pancreatic ductal adenocarcinoma (PDAC) is notoriously difficult to treat due to its aggressive, ever resilient nature. A major drawback lies in its tumor grade; a phenomenon observed across various carcinomas, where highly differentiated and undifferentiated tumor grades, termed as low
Yuji Atsuta et al.
Development (Cambridge, England), 143(19), 3549-3559 (2016-09-01)
The Müllerian duct (MD) and Wolffian duct (WD) are embryonic tubular tissues giving rise to female and male reproductive tracts, respectively. In amniote embryos, both MD and WD emerge in both sexes, but subsequently degenerate in the males and females
Nan Jia et al.
Oncotarget, 7(51), 84785-84797 (2016-10-21)
This work investigated the role of paired box 2 (PAX2) in endometrial cancer and its epigenetic regulation mechanism. Endometrial cancer tissues and cell lines exhibited increased PAX2 expression compared with hyperplasia, normal endometrium and endometrial epithelial cells. Knock-down of PAX2
Huanyu Zhao et al.
Molecular carcinogenesis, 54 Suppl 1, E112-E121 (2014-08-27)
Dishevelled-3 (Dvl-3) and p120-catenin (p120ctn) have abnormal expression in non-small cell lung cancer (NSCLC), which is associated with poor prognosis. Dvl-3 upregulates p120ctn transcription in NSCLC cells, but the mechanism is unknown. Here we transiently transfected Dvl-3 cDNA to NSCLC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique