Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU137721

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGACGAGAAAGAGTGCCTCAAGTACCAGGTGCCCCTGCCCGACAGCATGAAGCTGGAGTCGTCCCACTCCCGTGGCAGCATGACCGCCCTGGGTGGAGCCTCCTCGTCGACCCACCACCCCATCACCACCTACCCGCCCTACGTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCTGCTGGGCGGCTCCCCCACCGGCTTCGGATGCAAGTCCAGGCCCAAGGCCCGGTCCAGCACAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCCCACTGTGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTGCGGGCTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCAAGCGAAGGCTGTCTGCAGCCAGGAGAGCAGGGACGTCCTGTGCGAACTGTCAGAC

Numéro d'accès Ensembl | humain

ENSG00000107485

Numéro d'accès NCBI

NM_001002295

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GATA3(2625) , GATA3(2625)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yinghua Xu et al.
Oncotarget, 8(66), 110517-110529 (2018-01-05)
Lung adenocarcinoma (LAC) is the leading cause of cancer-related death worldwide. Aberrant expression of genes expressed preferentially in the lung tumor vasculature may yield clues for prognosis and treatment. Von Willebrand factor (vWF) is a large multifunctional glycoprotein with a
Shuangqin Wei et al.
Cancer management and research, 9, 769-780 (2017-12-22)
GATA3, a member of the GATA zinc finger transcription factor family, has been widely investigated for its role in cancer. Although a recent report has found that GATA3 is downregulated in gastric cancer (GC), the detailed mechanism of GATA3 in
Linjie Ma et al.
OncoTargets and therapy, 11, 7579-7589 (2018-11-23)
GATA3 functions as a tumor suppressor and has been observed in multiple types of cancer, but the effects and mechanisms of GATA3 in osteosarcoma (OS) are not yet known. The GATA3 expression in OS cells and tissues were detected using
Amr Ahmed El-Arabey et al.
Cellular signalling, 68, 109539-109539 (2020-01-15)
High-grade serous ovarian carcinoma (HGSOC) is the most lethal gynecologic cancer. Emerging evidence suggests that tumor-associated macrophages (TAMs) play an immunosuppressive role in the tumor microenvironment and promote tumor growth, angiogenesis, and metastasis in ovarian cancer. Therefore, targeting TAMs in
Mingjun Bi et al.
Nature cell biology, 22(6), 701-715 (2020-05-20)
Acquired therapy resistance is a major problem for anticancer treatment, yet the underlying molecular mechanisms remain unclear. Using an established breast cancer cellular model, we show that endocrine resistance is associated with enhanced phenotypic plasticity, indicated by a general downregulation
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique