Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU136981

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF


Date d'expédition estimée le18 avril 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF


Date d'expédition estimée le18 avril 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAAGCAGCAGATCCAGAGGCAGATCCTCATCGCTGAGTTCCAGAGGCAGCACGAGCAGCTCTCCCGGCAGCACGAGGCGCAGCTCCACGAGCACATCAAGCAACAACAGGAGATGCTGGCCATGAAGCACCAGCAGGAGCTGCTGGAACACCAGCGGAAGCTGGAGAGGCACCGCCAGGAGCAGGAGCTGGAGAAGCAGCACCGGGAGCAGAAGCTGCAGCAGCTCAAGAACAAGGAGAAGGGCAAAGAGAGTGCCGTGGCCAGCACAGAAGTGAAGATGAAGTTACAAGAATTTGTCCTCAATAAAAAGAAGGCGCTGGCCCACCGGAATCTGAACCACTGCATTTCCAGCGACCCTCGCTACTGGTACGGGAAAACGCAGCACAGTTCCCTTGACCAGAGTTCTCCACCCCAGAGCGGAGTGTCGACCTCCTATAACCACCCGGTCCTGGGAATGTACGACGCCAAAGATGACTTCCCTCTTAGGAAAACAGCTTCTGAACCGAATCTGAAATTACGGTCCAGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Todd J Cohen et al.
Molecules and cells, 38(4), 343-348 (2015-03-03)
Fiber type-specific programs controlled by the transcription factor MEF2 dictate muscle functionality. Here, we show that HDAC4, a potent MEF2 inhibitor, is predominantly localized to the nuclei in fast/glycolytic fibers in contrast to the sarcoplasm in slow/oxidative fibers. The cytoplasmic
Ling X Zhang et al.
American journal of physiology. Cell physiology, 307(4), C358-C372 (2014-06-20)
We have recently shown that in vivo inhibition of histone deacetylase (HDAC) stimulates endogenous myocardial regeneration in infarcted hearts (Zhang L et al. J Pharmacol Exp Ther 341: 285-293, 2012). Furthermore, our observation demonstrates that HDAC inhibition promotes cardiogenesis, which
GuoLiang Zou et al.
Biochimie, 165, 90-99 (2019-05-13)
The cardioprotection of catalpol and its mechanism in diabetic cardiomyopathy (DCM) remains unclear. Here, mouse cardiomyocytes were treated with high glucose (HG) to establish a model of cellular injury induced by HG. In vitro experiments were carried out and confirmed that
Y Yang et al.
Oncogene, 30(19), 2207-2218 (2011-01-19)
The transcriptional activity of the androgen receptor (AR) is regulated by both ligand binding and post-translational modifications, including acetylation and small ubiquitin-like modifier (SUMO)ylation. Histone deacetylases (HDACs) are known to catalyze the removal of acetyl groups from both histones and
Jung-Won Lee et al.
Nature communications, 10(1), 1897-1897 (2019-04-25)
The cellular decision regarding whether to undergo proliferation or death is made at the restriction (R)-point, which is disrupted in nearly all tumors. The identity of the molecular mechanisms that govern the R-point decision is one of the fundamental issues

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique