Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU131531

Sigma-Aldrich

MISSION® esiRNA

targeting human SF3B1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGGAGTTGGCAAACAAAGTAGGTGCAGCAGAAATTATATCCAGGATTGTGGATGATCTGAAAGATGAAGCCGAACAGTACAGAAAAATGGTGATGGAGACAATTGAGAAAATTATGGGTAATTTGGGAGCAGCAGATATTGATCATAAACTTGAAGAACAACTGATTGATGGTATTCTTTATGCTTTCCAAGAACAGACTACAGAGGACTCAGTAATGTTGAACGGCTTTGGCACAGTGGTTAATGCTCTTGGCAAACGAGTCAAACCATACTTGCCTCAGATCTGTGGTACAGTTTTGTGGCGTTTAAATAACAAATCTGCTAAAGTTAGGCAACAGGCAGCTGACTTGATTTCTCGAACTGCTGTTGTCATGAAGACTTGTCAAGAGGAAAAATTGATGGGACACTTGGGTGTTGTATTGTATGAGTATTTGGGTGAAGAGTACCCTGAAGTATTGGGCAGCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Juan L López-Cánovas et al.
Cancer letters, 496, 72-83 (2020-10-11)
Splicing alterations represent an actionable cancer hallmark. Splicing factor 3B subunit 1 (SF3B1) is a crucial splicing factor that can be targeted pharmacologically (e.g. pladienolide-B). Here, we show that SF3B1 is overexpressed (RNA/protein) in hepatocellular carcinoma (HCC) in two retrospective
Pablo Baeza-Centurion et al.
Cell, 176(3), 549-563 (2019-01-22)
Despite a wealth of molecular knowledge, quantitative laws for accurate prediction of biological phenomena remain rare. Alternative pre-mRNA splicing is an important regulated step in gene expression frequently perturbed in human disease. To understand the combined effects of mutations during

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique