Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU130881

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGATTTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGGATGGCAGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiao-Guang Li et al.
EMBO reports, 20(6) (2019-05-16)
Intracellular tau accumulation forming neurofibrillary tangles is hallmark pathology of Alzheimer's disease (AD), but how tau accumulation induces synapse impairment is elusive. By overexpressing human full-length wild-type tau (termed hTau) to mimic tau abnormality as seen in the brain of
Wudian Xiao et al.
Microbial pathogenesis, 144, 104175-104175 (2020-04-01)
Trichophyton mentagrophytes (T. mentagrophytes) is the main cause of rabbit dermatophytosis. As the main pathogen-associated molecular pattern of T. mentagrophytes, the role of β-glucan in the pathogenesis of rabbit dermatophytosis remains elusive. Keratinocytes (KC) are the main cellular component and the first
Li-Xue Zou et al.
Cells, tissues, organs, 208(1-2), 13-24 (2020-02-12)
The aim of this work was to determine the effect of miR-375 on chondrocyte metabolism and oxidative stress in osteoarthritis (OA) mouse models through the JAK2/STAT3 signaling pathway. Chondrocytes were divided into control, IL-1β, IL-1β + miR-375 mimic, IL-1β +
Xilong Wang et al.
International journal of clinical and experimental pathology, 8(5), 5017-5025 (2015-07-21)
MicroRNAs (miRNAs) have emerged as important regulators that potentially play critical roles in cancer cell biological processes. Previous studies have shown that miR-204 plays an important role in various human cancers. However, the underlying mechanisms of this microRNA in breast
Yuanyuan Zhou et al.
Journal of physiology and biochemistry, 73(2), 259-266 (2017-01-31)
The primary features of Alzheimer's disease (AD) are extracellular amyloid plaques consisting mainly of deposits of amyloid β (Aβ) peptides and intracellular neurofibrillary tangles (NFTs). Sets of evidence suggest that interleukin-5 (IL-5) is involved in the pathogenesis of AD. Herein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique