Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU122711

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGEF12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGCAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTTACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCTGTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTTTCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGAAAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCAAGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTATGGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei-Chiao Chiu et al.
International journal of nanomedicine, 7, 5929-5939 (2012-12-13)
Studies to explore angiotensin II (Ang II) and its downstream signaling pathways via Rho guanine nucleotide exchange factors (RhoGEFs) and RhoA signaling are crucial to understanding the mechanisms of smooth muscle contraction leading to hypertension. This study aimed to investigate
Katsuhiko Hata et al.
The Journal of cell biology, 184(5), 737-750 (2009-03-11)
Neuronal axons are guided by attractive and repulsive cues in their local environment. Because the repulsive guidance molecule A (RGMa) was originally identified as an axon repellent in the visual system, diverse functions in the developing and adult central nervous
Michelle Rengarajan et al.
Molecular biology of the cell, 31(19), 2097-2106 (2020-06-26)
Interactions between host cells and individual pathogenic bacteria determine the clinical severity of disease during systemic infection in humans. Vascular endothelial cells, which line the lumen of blood vessels, represent a critical barrier for a bacterium in the bloodstream. These
Anil Prasad et al.
Scientific reports, 7, 40648-40648 (2017-01-18)
DC-SIGN is a dendritic cell surface structure which participates in binding and transmission of HIV-1. Here, for the first time we demonstrate that cocaine induces over expression of DC-SIGN and significantly enhances virus transfer from DCs to T-cells by increasing
Jing Cai et al.
Genes & development, 32(11-12), 781-793 (2018-06-13)
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited disorder caused by mutations in PKD1 or PKD2 and affects one in 500-1000 humans. Limited treatment is currently available for ADPKD. Here we identify the Hippo signaling effector YAP and its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique