Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU120691

Sigma-Aldrich

MISSION® esiRNA

targeting human RAC2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAGACCTGCCTTCTCATCAGCTACACCACCAACGCCTTTCCCGGAGAGTACATCCCCACCGTGTTTGACAACTATTCAGCCAATGTGATGGTGGACAGCAAGCCAGTGAACCTGGGGCTGTGGGACACTGCTGGGCAGGAGGACTACGACCGTCTCCGGCCGCTCTCCTATCCACAGACGGACGTCTTCCTCATCTGCTTCTCCCTCGTCAGCCCAGCCTCTTATGAGAACGTCCGCGCCAAGTGGTTCCCAGAAGTGCGGCACCACTGCCCCAGCACACCCATCATCCTGGTGGGCACCAAGCTGGACCTGCGGGACGACAAGGACACCATCGAGAAACTGAAGGAGAAGAAGCTGGCTCCCATCACCTACCCGCAGGGCCTGGCACTGGCCAAGGAGATTGACTCGGTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hailong Pei et al.
Cell cycle (Georgetown, Tex.), 16(1), 113-122 (2016-12-10)
Our recent study showed that quiescent G0 cells are more resistant to ionizing radiation than G1 cells; however, the underlying mechanism for this increased radioresistance is unknown. Based on the relatively lower DNA damage induced in G0 cells, we hypothesize
Peng Xia et al.
International journal of biological macromolecules, 137, 1221-1231 (2019-07-07)
Osteosarcoma (OS) is the most common primary malignancy of bone and is characterized by a high malignant and metastatic potential. Microarray-based differentially expressed gene screening determined RAC2 as the candidate gene related to OS. Highly expressed RAC2 and activated Wnt
Xu Zhang et al.
Cancer medicine, 8(12), 5716-5734 (2019-08-08)
The aim of this study is to investigate the functions and mechanisms of miR-608 in prostate cancer (PCa). CISH and qRT-PCR analysis demonstrated that miR-608 was low expressed in PCa tissues and cells, which was partly attributed to the methylation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique