Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU085781

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTTGCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCTTCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCAGACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCATCACCTCTGCTTTCCTC

Numéro d'accès Ensembl | humain

ENSG00000057663

Numéro d'accès NCBI

NM_004849

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATG5(9474) , ATG5(9474)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

ATG5 (autophagy protein 5) is involved in the formation of autophagosomes. It is part of the E3-like ATG12-ATG5-ATG16 complex, which is involved with autophagic vesicle formation and expansion. ATG5 is also needed for antigen presentation and thereby enhances viral clearance. Mutation in this gene decreases autophagy, thereby causing ataxia with developmental delay. The ATG5 gene is upregulated in systemic lupus erythematosus. It is also associated with Behçet′s disease. Polymorphisms in this gene are linked with neutrophilic airway inflammation, particularly in adult asthma.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Detecting Genetic Associations between ATG5 and Lupus Nephritis by trans-eQTL.
Zhang YM
Journal of immunology research, 2015, 153132-153132 (2015)
Association of autophagy related gene polymorphisms with neutrophilic airway inflammation in adult asthma.
Pham DL
The Korean Journal of Internal Medicine, 31, 375-375 (2016)
Mutation in ATG5 reduces autophagy and leads to ataxia with developmental delay.
Kim M
eLife, 5, e12245-e12245 (2016)
Yiming Shao et al.
Scientific reports, 7(1), 9399-9399 (2017-08-26)
Previous studies demonstrated significant roles of autophagy in the pathogenesis of sepsis, but few studies focused on the effect of autophagy-related SNPs on sepsis susceptibility. In this present study, five polymorphisms of ATG5/ATG16L1 were investigated for the possible risk on
RACK1 Is an Interaction Partner of ATG5 and a Novel Regulator of Autophagy.
Erbil S
The Journal of Biological Chemistry, 291, 16753-16753 (2016)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique