Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU085291

Sigma-Aldrich

MISSION® esiRNA

targeting human JMJD6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTTGTTGAATGCGCAAGAGGGCTGGTCTGCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAATATCGGAACCAGAAGTTCAAGTGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTACATCGAGTACATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACACCCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTTTTCCAGTATGCTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCACGCTCCGGAACTGGGATTCACATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTTCAGGGCCACAAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chang-Ryul Lee et al.
Carcinogenesis, 37(2), 119-128 (2015-12-10)
Cancer stem cells (CSCs) are defined as a small subpopulation of cancer cells within a tumor and responsible for initiation and maintenance of tumor growth. Thus, understanding of molecular regulators of CSCs is of paramount importance for the development of
Yan Liu et al.
Oncogene, 38(7), 980-997 (2018-09-07)
Overexpression of Jumonji domain-containing 6 (JMJD6) has been reported to be associated with more aggressive breast cancer characteristics. However, the precise role of JMJD6 in breast cancer development remains unclear. Here, we demonstrate that JMJD6 has intrinsic tyrosine kinase activity
Alec Paschalis et al.
Cancer research, 81(4), 1087-1100 (2021-04-07)
Endocrine resistance (EnR) in advanced prostate cancer is fatal. EnR can be mediated by androgen receptor (AR) splice variants, with AR splice variant 7 (AR-V7) arguably the most clinically important variant. In this study, we determined proteins key to generating

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique