Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU078191

Sigma-Aldrich

MISSION® esiRNA

targeting human TTC3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTCTGAGCCAGCATCATTGAAGGAAGCCCGTTGTTTAATATGGCTGCTAGAAGAACACAGAGACAAGTTCCCAGCATTGCATAGTGCTTTAGATGAATTCTTTGATATAATGGACAGCCGCTGTACTGTGTTAAGGAAACAAGATAGTGGTGAAGCACCGTTTAGTTCAACCAAGGTGAAAAACAAAAGCAAGAAAAAGAAGCCAAAGGATTCAAAGCCTATGTTAGTTGGGTCTGGAACAACTTCAGTAACTTCAAATAATGAGATCATCACTTCAAGTGAAGACCATAGCAATCGAAATTCAGATTCTGCAGGCCCATTTGCAGTGCCTGACCATCTTCGGCAAGATGTAGAAGAATTCGAAGCTCTCTATGACCAACACAGTAACGAATATGTTGTCCGCAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bo Yang et al.
Stem cell research & therapy, 12(1), 125-125 (2021-02-14)
Stroke serves as a prevalent cerebrovascular disorder with severe cerebral ischemia/reperfusion (CIR) injury, in which neural stem cells (NSCs) play critical roles in the recovery of cerebral function. Circular RNAs (circRNAs) have been widely found to participate in stroke and
Chong Huang et al.
Molecular medicine reports, 16(5), 6269-6275 (2017-08-30)
Smoking is highly associated with cardiovascular diseases. However, the effect of nicotine, a key ingredient in smoking products, on cardiomyocyte apoptosis remains controversial. The present study aims to clarify the role of nicotine on cardiomyocyte cell apoptosis and to investigate

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique