Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU075161

Sigma-Aldrich

MISSION® esiRNA

targeting human SETD2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGGAAAGGGATTTGCTTCCAGGGAGAACAGGCGTAATAATGGGTTATCTGGGAAATGTTTGCAAGAGGCTCAAGAAGAAGGGAATTCCATATTGCCTGAAAGAAGAGGAAGACCAGAAATCTCTTTAGATGAAAGAGGAGAAGGAGGACATGTGCATACTTCTGATGACTCAGAAGTTGTATTTTCTTCTTGTGATTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTAGTGGTCATGCCCCAGAAATTGTGTCTACAGTTCATGAAGATTATTCTGGCTCTTCTGAAAGTTCAAATGATGAAAGTGATTCAGAAGATACAGATTCGGATGATAGCAGTATTCCAAGAAACCGTCTCCAGTCTGTTGTGGTTGTGCCAAAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

You Zhou et al.
Aging, 12(24), 25189-25206 (2020-11-24)
The histone H3 lysine 36 methyltransferase SET-domain-containing 2 (SETD2) has been reported to be frequently mutated or deleted in many types of human cancer. However, the role of SETD2 in lung adenocarcinoma (LUAD) has not been well documented. In the
Sergej Pirkmajer et al.
Frontiers in physiology, 11, 566584-566584 (2020-10-27)
The cardiotonic steroids (CTS), such as ouabain and marinobufagenin, are thought to be adrenocortical hormones secreted during exercise and the stress response. The catalytic α-subunit of Na,K-ATPase (NKA) is a CTS receptor, whose largest pool is located in skeletal muscles
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
Na Liu et al.
Oncology reports, 32(6), 2397-2404 (2014-10-22)
Previously, we reported that hypoxia was able to induce invasion and metastasis in gastric cancer and that hypoxia-inducible factor-1 (HIF-1) is a key factor involved in this tumor type. Krüppel-like factor 8 (KLF8) as a transcriptional repressor has been suggested

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique